ID: 1160371328

View in Genome Browser
Species Human (GRCh38)
Location 18:78374063-78374085
Sequence CTGTGTCAGAGCATTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160371324_1160371328 10 Left 1160371324 18:78374030-78374052 CCAGGAGGCAGCAGGGGCTGCAC No data
Right 1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160371328 Original CRISPR CTGTGTCAGAGCATTGAGCT CGG Intergenic
No off target data available for this crispr