ID: 1160373472

View in Genome Browser
Species Human (GRCh38)
Location 18:78392806-78392828
Sequence TACGCAGCGCCATCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160373472_1160373476 -7 Left 1160373472 18:78392806-78392828 CCCCTCTTGGATGGCGCTGCGTA No data
Right 1160373476 18:78392822-78392844 CTGCGTATCCAGAGGACCATAGG No data
1160373472_1160373479 22 Left 1160373472 18:78392806-78392828 CCCCTCTTGGATGGCGCTGCGTA No data
Right 1160373479 18:78392851-78392873 GCTGATGAGTTTAATTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160373472 Original CRISPR TACGCAGCGCCATCCAAGAG GGG (reversed) Intergenic
No off target data available for this crispr