ID: 1160378708

View in Genome Browser
Species Human (GRCh38)
Location 18:78432579-78432601
Sequence CCTTGTATGCTGATTGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160378708_1160378716 3 Left 1160378708 18:78432579-78432601 CCCGCTTCAATCAGCATACAAGG No data
Right 1160378716 18:78432605-78432627 TCCTGGGGGATTCTTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160378708 Original CRISPR CCTTGTATGCTGATTGAAGC GGG (reversed) Intergenic
No off target data available for this crispr