ID: 1160379355

View in Genome Browser
Species Human (GRCh38)
Location 18:78439724-78439746
Sequence CCAATCTGTCTGTCCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160379351_1160379355 -8 Left 1160379351 18:78439709-78439731 CCCTCAGGCCTGCGTCCAATCTG No data
Right 1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG No data
1160379350_1160379355 5 Left 1160379350 18:78439696-78439718 CCACGTGGAGCAACCCTCAGGCC No data
Right 1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG No data
1160379347_1160379355 26 Left 1160379347 18:78439675-78439697 CCTCAGAGTTTGGAGGAGGGACC No data
Right 1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG No data
1160379352_1160379355 -9 Left 1160379352 18:78439710-78439732 CCTCAGGCCTGCGTCCAATCTGT No data
Right 1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160379355 Original CRISPR CCAATCTGTCTGTCCAACAC AGG Intergenic
No off target data available for this crispr