ID: 1160380207

View in Genome Browser
Species Human (GRCh38)
Location 18:78448797-78448819
Sequence CCTATTAGAAACCATGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380207_1160380214 9 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380214 18:78448829-78448851 TAAAAGAAAGAGGGGCTCTCTGG No data
1160380207_1160380211 0 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG 0: 3
1: 0
2: 34
3: 212
4: 932
1160380207_1160380212 1 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380212 18:78448821-78448843 TTCTCCAATAAAAGAAAGAGGGG No data
1160380207_1160380210 -1 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380210 18:78448819-78448841 GATTCTCCAATAAAAGAAAGAGG No data
1160380207_1160380216 28 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data
1160380207_1160380217 29 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380217 18:78448849-78448871 TGGAGAAATGGCTGATTGTAGGG No data
1160380207_1160380215 17 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380215 18:78448837-78448859 AGAGGGGCTCTCTGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380207 Original CRISPR CCTATTAGAAACCATGATTT GGG (reversed) Intergenic
No off target data available for this crispr