ID: 1160380209

View in Genome Browser
Species Human (GRCh38)
Location 18:78448798-78448820
Sequence TCCTATTAGAAACCATGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380209_1160380216 27 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data
1160380209_1160380210 -2 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380210 18:78448819-78448841 GATTCTCCAATAAAAGAAAGAGG No data
1160380209_1160380217 28 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380217 18:78448849-78448871 TGGAGAAATGGCTGATTGTAGGG No data
1160380209_1160380215 16 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380215 18:78448837-78448859 AGAGGGGCTCTCTGGAGAAATGG No data
1160380209_1160380211 -1 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG No data
1160380209_1160380214 8 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380214 18:78448829-78448851 TAAAAGAAAGAGGGGCTCTCTGG No data
1160380209_1160380212 0 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380212 18:78448821-78448843 TTCTCCAATAAAAGAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380209 Original CRISPR TCCTATTAGAAACCATGATT TGG (reversed) Intergenic