ID: 1160380211

View in Genome Browser
Species Human (GRCh38)
Location 18:78448820-78448842
Sequence ATTCTCCAATAAAAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1181
Summary {0: 3, 1: 0, 2: 34, 3: 212, 4: 932}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380209_1160380211 -1 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG 0: 3
1: 0
2: 34
3: 212
4: 932
1160380207_1160380211 0 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG 0: 3
1: 0
2: 34
3: 212
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380211 Original CRISPR ATTCTCCAATAAAAGAAAGA GGG Intergenic
900723471 1:4197164-4197186 ATTAACCAATAAAAGAAAGAAGG + Intergenic
901264543 1:7900391-7900413 TGTCTCCAAAAAAAGAAAGAAGG + Intergenic
902393140 1:16117857-16117879 ATTGTCCACTTAAAGACAGAAGG + Intergenic
902407484 1:16192997-16193019 ATGCTCAAAAAACAGAAAGATGG + Intergenic
902426606 1:16328736-16328758 GTTCTCCAATAAAAGAAACCAGG + Intronic
903328712 1:22586101-22586123 AGTGTCCCATAAAAGAGAGAAGG + Intronic
903788869 1:25879077-25879099 TGTCTCCAAAAAAAGAAAAAAGG - Intergenic
903991430 1:27273033-27273055 ATTCTCTATTAAAAGGAAGCAGG + Intronic
904217535 1:28934805-28934827 ATTATCCAATAAAAGGAATGGGG - Intronic
904292266 1:29495543-29495565 ATTTTCCAATAAAAGGAATCTGG - Intergenic
904669401 1:32151813-32151835 AATATCCAACAAAAGAAAAAGGG + Intronic
906891643 1:49722442-49722464 ATTCTCCAAGTAAACAAATAAGG + Intronic
907076274 1:51581994-51582016 ATTGTCCAATAAAAGGAACTAGG - Intronic
907361589 1:53920664-53920686 ATTCTTAAATAAGAGAAAGAGGG + Intronic
907768739 1:57438566-57438588 ATTTTCCAGCAAAATAAAGAAGG + Intronic
907995526 1:59627675-59627697 TTTCTCCAATAAAAGTAATCAGG + Intronic
908020770 1:59896130-59896152 ATTATCCACTAAAAGAAACCAGG - Intronic
908087138 1:60647660-60647682 ATCCTCCAATAAAAGGAACTAGG + Intergenic
908699049 1:66878448-66878470 ATTCTCTAATAAAAGCAACTAGG - Intronic
908804616 1:67917372-67917394 ATTTTACAATAAAAGAAATTAGG - Intergenic
909107638 1:71432591-71432613 ATTATCCACTAAAGGAACGAAGG + Intronic
909247730 1:73309759-73309781 ATTCTTCAATAAAAGTAACAAGG + Intergenic
909517438 1:76527865-76527887 CGTCTCCAAAAGAAGAAAGAGGG + Intronic
909628962 1:77750941-77750963 ATTGTACACCAAAAGAAAGAAGG + Intronic
909830271 1:80180098-80180120 ATTCTCCAATAAGAGAAACCAGG + Intergenic
910046053 1:82918431-82918453 ATTCTCCAATATTAAAAATATGG + Intergenic
910446901 1:87307912-87307934 TTTCTTAAACAAAAGAAAGAAGG - Intergenic
910477956 1:87627140-87627162 ATTCTCAATTACAAGAAACAAGG + Intergenic
910602317 1:89044626-89044648 AGTCTCCAAGTAAAGAAAAAAGG + Intergenic
910909718 1:92220184-92220206 ATTCTCCAAAAAAGGAACCAGGG - Intronic
911113779 1:94221857-94221879 ATTCTCCAATGAAAGTAATCAGG + Intronic
911215545 1:95188838-95188860 ACTCTCCAATGAAAGAAACTAGG - Intronic
911419463 1:97621692-97621714 ATTATCCAATAAAAGAAATCAGG + Intronic
911488517 1:98532692-98532714 ATTATCCAATAAAAGATATGTGG - Intergenic
911769996 1:101728817-101728839 AATTTCCAATGAAAGACAGAAGG - Intergenic
911816384 1:102357989-102358011 ATACACCAACAAAAGACAGAGGG + Intergenic
911872226 1:103112571-103112593 ATTTTCCAATCAAAGATAGAAGG + Intergenic
911896610 1:103443791-103443813 ATTCTCTAATAAAAAAAACTTGG + Intergenic
912394673 1:109332930-109332952 CATCTCAAAAAAAAGAAAGAAGG - Intronic
912561927 1:110557085-110557107 ATTCTTCAATAAAATGAGGAGGG - Intergenic
912802759 1:112730966-112730988 ATTCTACAAAAAAAAAAAAAAGG - Intergenic
913133772 1:115867130-115867152 ATTCTCCAAGAACAGAAACAGGG - Intergenic
914034769 1:143991776-143991798 TGTCTCCAAAAAAAAAAAGATGG + Intergenic
914257567 1:145973126-145973148 ATTTTCCAATAAAAGGAACCAGG - Intronic
916077836 1:161212852-161212874 ATTCTCTATTAAAAGAAAACTGG - Intronic
916646600 1:166792755-166792777 ATTATCCTATAAAAGTAATAAGG - Intergenic
916948246 1:169752140-169752162 ATTCTCCATTAAAAGGAACAAGG + Intronic
917322330 1:173796450-173796472 ATTATCAAAAAAAAGAAAAAAGG + Intergenic
917557657 1:176107320-176107342 TTTCTCCACTAAAAGAAAAGAGG + Intronic
917762827 1:178182370-178182392 ATTCTCCAATAAAAGGAACCAGG - Intronic
917837340 1:178951914-178951936 ATTCTCCATTAAAAGGAACCAGG - Intergenic
918436764 1:184522413-184522435 ATTCTCCAATAAAAGGAACTAGG + Intronic
918894250 1:190319412-190319434 ATTCTCTAATAATGGAAACAGGG - Intronic
919056185 1:192571845-192571867 ATTCTCAAATTATAGAAAGGAGG + Intergenic
919873352 1:201841599-201841621 ATTCTCCACTAAAAGACAGCAGG + Intronic
920443913 1:206001273-206001295 ATTCTAAAAAAAAAAAAAGACGG - Intronic
920470238 1:206222664-206222686 TGTCTCCAAAAAAAAAAAGATGG + Intronic
920637323 1:207716504-207716526 ATTTTCCAATAAGAAAAAAAAGG - Intronic
920716554 1:208345507-208345529 GTTCCCCAATTAAAGAAAAAAGG + Intergenic
921667637 1:217891750-217891772 ATTCTACAATAAAAGGAACCAGG + Intergenic
921729960 1:218566750-218566772 ATTCTCCAATAAGAGAAACCAGG + Intergenic
921802586 1:219418300-219418322 ATTCACAAATAAAAGATAAAGGG + Intergenic
921969036 1:221124683-221124705 ATTCTGCAATAAAAGGAACCTGG - Intergenic
922139132 1:222863951-222863973 ATTCTCCATTAAAAGGAAACAGG - Intergenic
922140942 1:222885689-222885711 ATTCTTCAATAAAAGAAACCAGG - Intronic
922168779 1:223137829-223137851 ATTTGGCCATAAAAGAAAGAAGG - Intronic
922403630 1:225287702-225287724 ATTCTCCAATAAAAGGAACCAGG + Intronic
923000534 1:230003207-230003229 CTTCTACAAAAAAAGAATGAGGG - Intergenic
923099373 1:230800166-230800188 AGACTCCATCAAAAGAAAGAAGG + Intronic
923340270 1:233000832-233000854 ATATTCCACTAGAAGAAAGATGG - Intronic
923483624 1:234407900-234407922 ATTCTCCAATAAAACGAACCAGG - Intronic
923833503 1:237583909-237583931 TTCCTCCAACAAAAGACAGATGG - Intronic
924677681 1:246196874-246196896 ATTCTCCAATAAAAGAAAACAGG + Intronic
1062990776 10:1813775-1813797 ATTTACCTATAAAAGAAAGATGG + Intergenic
1063026505 10:2184082-2184104 GTTCTCCAATAAAAGAAACCAGG + Intergenic
1063166033 10:3463280-3463302 ATTCTGCTATAAAAAAAACAAGG - Intergenic
1063245120 10:4209658-4209680 ATTCTTCAATTAAAAAAAAACGG + Intergenic
1063285756 10:4685955-4685977 ATTATTCAGTTAAAGAAAGAAGG - Intergenic
1063889066 10:10610913-10610935 ATTGTCCAAATAAAGAAAGATGG + Intergenic
1064870520 10:19931823-19931845 ATTCTTCATTCACAGAAAGAGGG - Intronic
1065134298 10:22653080-22653102 TATCTCAAAAAAAAGAAAGAAGG + Intronic
1065160850 10:22919775-22919797 ATTCTCCAATAAAGGAAACCGGG - Intergenic
1065200956 10:23312500-23312522 ATTCTACACTAAAAGAAACCAGG - Intronic
1065731071 10:28710146-28710168 ATTGTCCAATAAAAAAAACATGG - Intergenic
1065793706 10:29285438-29285460 ATTCTCCAGTAAAAGAAACCAGG - Intergenic
1065948932 10:30634038-30634060 ATTCTCCAGTAAAAGAAACCAGG + Intergenic
1066031001 10:31424567-31424589 ATTCTGAAATGAAACAAAGAAGG - Intronic
1066543251 10:36472075-36472097 ATGCTCTATTAAAAGCAAGAAGG + Intergenic
1067001040 10:42613860-42613882 ATTCTCAAATAAAAGGAAACAGG + Intronic
1067402445 10:45989466-45989488 TATATCCAAAAAAAGAAAGAAGG - Intronic
1067870795 10:49959094-49959116 TATATCCAAAAAAAGAAAGAAGG - Intronic
1068079447 10:52301425-52301447 ATTTTACAATAAAAGCAAGTTGG + Intergenic
1068408024 10:56618400-56618422 ATGCTCCAATAGAAGAAACCAGG + Intergenic
1068452974 10:57216574-57216596 ATTCTCCAATAAAAGGAAGCAGG + Intergenic
1068563771 10:58547931-58547953 AGTCTCCAATAAAAGAAACCAGG - Intronic
1068957640 10:62833688-62833710 ATTCTCCAATAAAAGGAACCAGG + Intronic
1069027881 10:63563375-63563397 GTTCTCCAATAAAAGGAACTGGG + Intronic
1069089193 10:64178745-64178767 ATTGTCCAAGTAAATAAAGATGG + Intergenic
1069249385 10:66248424-66248446 ACTCTCCAATAAAAAAGACATGG + Intronic
1069399565 10:68028546-68028568 ATTCTCCACTAAAAGGAACCAGG - Intronic
1069503558 10:68976219-68976241 TATCTCAAAAAAAAGAAAGAGGG + Intronic
1070219074 10:74421631-74421653 ATTCTCCAATAAAAGGATCCAGG + Intronic
1070468860 10:76756950-76756972 ATTCTCTGATAAAAGAAACCAGG + Intergenic
1070599064 10:77853289-77853311 ATTCTCCATTAAAAGGAATGAGG + Intronic
1070651681 10:78241872-78241894 ATTCTCCACTAAAAGGAACAAGG - Intergenic
1071478898 10:86048231-86048253 ATTCTCTATTAAAAAAAATATGG - Intronic
1071547790 10:86541482-86541504 ATTCTCTAATAAAAGGAACTAGG + Intergenic
1071675164 10:87648735-87648757 ATTCGTCAATAAAAGAAACCAGG - Intergenic
1072021579 10:91409108-91409130 AACCTCCAATAAAATAATGAAGG + Intergenic
1072297551 10:94025783-94025805 ATTCTTCAAATAAATAAAGATGG + Intronic
1072417987 10:95264752-95264774 TTTCTCAAATTACAGAAAGAGGG - Intronic
1072526973 10:96280830-96280852 ATTCTCCACTAAAAGGAACCAGG + Intergenic
1072577598 10:96714552-96714574 ATTCTCCAATAAAAGGATCCAGG + Intronic
1072863817 10:99036255-99036277 ATTCTACAATAAAAGAAACCAGG + Intronic
1072875113 10:99164508-99164530 ATTCTCCAACAAAAGGAACCAGG - Intronic
1072958757 10:99910598-99910620 ATTCTCCACTAAAAGGAGGCAGG + Intronic
1073385452 10:103123690-103123712 ATTCTGAAATAACAGAAATAAGG + Intronic
1073590477 10:104752579-104752601 CTTCTCAAATAAATGGAAGAGGG - Intronic
1073651017 10:105358120-105358142 GTTTTCCCATAAAAGAATGAAGG - Intergenic
1074218580 10:111412458-111412480 ATTCTCCAATAAAAGAAACCAGG - Intergenic
1074253317 10:111775863-111775885 TTTCTCCAGCAAGAGAAAGATGG + Intergenic
1074385670 10:113014832-113014854 AGTCTCCCATAAAGGACAGAAGG - Intronic
1074543701 10:114386395-114386417 CATCTCCAAAAAAAGAAAAAAGG + Intronic
1074671257 10:115795103-115795125 ATTTTCCACTAAAAGAAACCAGG - Intronic
1074677093 10:115863768-115863790 ATTCTCCAATAAAATGAACAAGG + Intronic
1074694901 10:116041568-116041590 ATCCTCCATTAAAAGAAACCAGG - Intergenic
1074743549 10:116508345-116508367 ATTTTCAAAAAAAAGAAAGTCGG + Intergenic
1074800763 10:116998786-116998808 ATTCTCGAATAAAACGAACAGGG - Intronic
1075062071 10:119264016-119264038 ATTCTGCAAGAGAAGACAGATGG + Intronic
1075172072 10:120125030-120125052 ATTCTCCAATAAAAGGATCCAGG - Intergenic
1075361919 10:121846014-121846036 ATTCTGCAATAAAAGAAACCAGG + Intronic
1075480363 10:122775891-122775913 ATTCACCACTAAAAGAAAACGGG + Intergenic
1075678047 10:124310267-124310289 ATTCTCCAGCAAAATGAAGAAGG + Intergenic
1076121205 10:127937999-127938021 ATTTTTTAAAAAAAGAAAGAAGG + Intronic
1076155224 10:128199423-128199445 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1076977274 11:183585-183607 ATTCTCTAACAAAAGAAATCAGG + Intronic
1077874006 11:6288177-6288199 GTTCTCCTATAAAAGGCAGAAGG + Intergenic
1078310239 11:10233606-10233628 ATTCTCCAAAAAAAAAAAAAAGG + Intronic
1078315616 11:10290923-10290945 ATTCTCCACTAAAAGGAACCAGG + Intronic
1078571711 11:12464078-12464100 GTTCTCCAATAAAAGTAACCAGG - Intronic
1078573741 11:12481538-12481560 ATTCTCTAATAAAATAAATCAGG - Intronic
1078824999 11:14921161-14921183 ATTCTCCAATAAAAGGAAGCAGG + Intronic
1079505401 11:21147340-21147362 ATTCTCCAAGAAAACAAATTTGG - Intronic
1079607694 11:22390746-22390768 ATTATGCAATAAAAGAAGAATGG + Intergenic
1079689359 11:23403365-23403387 ATGCTCAAAGAAAAGGAAGAGGG + Intergenic
1079734015 11:23972749-23972771 AATCTACAGTAAAAGAAAAATGG - Intergenic
1080677481 11:34440891-34440913 ATTCTCCCAAACAAGGAAGAAGG - Intronic
1080911833 11:36608406-36608428 TTTCTCCAATAATGGAAGGAAGG - Intronic
1081132972 11:39403045-39403067 ATTCTCCCATAAAAGGAACCAGG + Intergenic
1081142512 11:39519974-39519996 AATATCCAAAAGAAGAAAGATGG + Intergenic
1081382755 11:42435809-42435831 ATTCTCCATGATTAGAAAGAAGG - Intergenic
1081926877 11:46837543-46837565 ATTCTCCAATAAGGGAACCAGGG + Intronic
1082134910 11:48536851-48536873 ATTCTCCCATTAAAGTGAGAAGG + Intergenic
1082204804 11:49420299-49420321 ATTCTCCAATAAAGGGAACTGGG + Intergenic
1082303438 11:50540373-50540395 ATCCTACAATAAAAAATAGAAGG - Intergenic
1082655920 11:55857030-55857052 ATTGTGCAAAAAGAGAAAGAGGG - Intergenic
1082922681 11:58512770-58512792 ATTCTCTAATAAAAGAAACCAGG + Intergenic
1083448699 11:62727933-62727955 GTTGTCCAATAAGAGAAAAAGGG - Intergenic
1083631206 11:64096414-64096436 AGTCTCAAAAAAAAAAAAGAGGG - Intronic
1084194307 11:67515555-67515577 ATTCTCCAATAAAATGAACCAGG + Intergenic
1084926623 11:72518640-72518662 ATTATTTAATAAAAGAAAGCAGG + Intergenic
1085424897 11:76395616-76395638 ATTCTCCAATAAAAGGAACCAGG - Intronic
1085441597 11:76568931-76568953 ATTCTCCAATAAAAGGGACCAGG - Intergenic
1085862686 11:80253115-80253137 TTTCTCCAATAAAAGGAATCAGG + Intergenic
1086241229 11:84694612-84694634 ATTCTCTGATAAAACAAAGTAGG - Intronic
1086345742 11:85893973-85893995 ATTCTACATTATAAGAAAGCTGG - Intronic
1086505903 11:87504020-87504042 ATACACCAATAACAGACAGAGGG - Intergenic
1086568334 11:88252976-88252998 ATTCTCCAACAAAAGAAAACAGG + Intergenic
1086720152 11:90110538-90110560 ATTTACCAATAAAAGTAAGTGGG - Intergenic
1086749150 11:90468634-90468656 ATTGTCCAATAAAAGGAACCAGG + Intergenic
1087109711 11:94451177-94451199 TGTCTCGAAAAAAAGAAAGAAGG + Intronic
1087236326 11:95722936-95722958 ATTCTCCAGTAAAAGGAACTAGG + Intergenic
1087535257 11:99435760-99435782 ATTCTCCAATAAATGATGGTAGG - Intronic
1087906126 11:103699788-103699810 TGTCTCCAAAAAAAGAAGGAAGG - Intergenic
1087990690 11:104743289-104743311 CTTCTACAATAAAAAAAAAAAGG - Intergenic
1088124386 11:106405735-106405757 ATTCTCCAATAAAAGAAACTCGG - Intergenic
1088133583 11:106526169-106526191 ATTCTCCAATAATAGAAACCAGG - Intergenic
1088168863 11:106971815-106971837 ATTCTCCAATAAAAGGTATCAGG + Intronic
1088340697 11:108762842-108762864 ATTGTCCGAGAAAGGAAAGAAGG - Intronic
1089006447 11:115095382-115095404 ATTCTCCAATAAAAGGAACCAGG + Intergenic
1089481442 11:118808441-118808463 GTTCTCCACTAAAAGAAACCAGG + Intergenic
1089550632 11:119273706-119273728 CTTCTTTAAGAAAAGAAAGAAGG - Intronic
1089636335 11:119815181-119815203 ATTATCCACTAAAAAAAAAATGG - Intergenic
1089995661 11:122904764-122904786 ATTCTCCATTCAAAGAAATCTGG + Intronic
1090532112 11:127601369-127601391 ATTCTCCCATAAAGAACAGATGG - Intergenic
1090538349 11:127671638-127671660 TTTCTCCAATAAAAGGAACAGGG + Intergenic
1090707443 11:129351789-129351811 ATTCTCCACTAAAAGGAGAAGGG - Intergenic
1091354536 11:134925860-134925882 ATTCTGCAATAAAAGAAACCAGG - Intergenic
1091809712 12:3386273-3386295 ATTCTCAATCAAAAGAGAGATGG - Intronic
1092008716 12:5090649-5090671 ATTCTCCAAGGAAAGAAATCAGG - Intergenic
1092158353 12:6299908-6299930 TGTCTCCAAAAAAAAAAAGAAGG + Intergenic
1092386880 12:8042585-8042607 ATTTTCCAATAGAACACAGAGGG - Intronic
1092396536 12:8132290-8132312 ATTCTCCAATCAAAGGAACTAGG - Intronic
1092775364 12:11940747-11940769 ATTCTCCACTAAAAAGAACAAGG + Intergenic
1092888561 12:12947560-12947582 AATTTAAAATAAAAGAAAGAAGG - Intronic
1093114566 12:15193496-15193518 ATTCTCCAATAGAAGGCAGATGG - Intronic
1093151805 12:15630453-15630475 ATTCACCAATAATACAAATAAGG + Intronic
1093318768 12:17685558-17685580 ATTCTCCAATAAAAATAAGAAGG - Intergenic
1093390808 12:18618283-18618305 AGTCCCCGATAAAAGACAGAAGG + Intronic
1093679976 12:21991113-21991135 ATTCTCCATTTAAAGCAACAGGG + Intergenic
1094450623 12:30579881-30579903 ATTTTCCAAGTAAAAAAAGAGGG + Intergenic
1094456830 12:30644363-30644385 AATCTCCATTAAAAAAAAAAAGG + Intronic
1094634053 12:32206600-32206622 CTTCTCAAAAAAAAGAAAGAAGG + Intronic
1094717359 12:33026180-33026202 ATCCTCCCATAAAATAAGGATGG + Intergenic
1095041153 12:37442356-37442378 AGCTTCCATTAAAAGAAAGAGGG + Intergenic
1095140806 12:38659813-38659835 ATACACCAATAACAGACAGAGGG + Intronic
1095142883 12:38688220-38688242 ATTCTCAAAGAAGAGAAAAATGG - Intronic
1095581920 12:43810052-43810074 ACTTTCCAATGAAAGAAACAGGG + Intergenic
1095618406 12:44220622-44220644 ATTCTCCAATAAAAGGAACCAGG + Intronic
1095893224 12:47254307-47254329 ATTCTACAAGATAGGAAAGAAGG + Intergenic
1095927927 12:47597575-47597597 ATTCCCCATTAAAAGAAACCAGG - Intergenic
1095928085 12:47599191-47599213 ATTCTCCACTAAAAGGAACCAGG + Intergenic
1095928121 12:47599647-47599669 ATTCTCCACTAAAAGGAACCAGG - Intergenic
1096281438 12:50258155-50258177 CTTCTCCCATAAAAGAAAACAGG - Intronic
1096599278 12:52717974-52717996 CTTCTACAACAGAAGAAAGAAGG + Intergenic
1096929376 12:55188932-55188954 TTTCTAGAATAATAGAAAGATGG + Intergenic
1097458913 12:59835491-59835513 ATTCTCCAATAAAAGGAACAAGG - Intergenic
1097670673 12:62533680-62533702 ATTCTCCACTAAAAGGAACCAGG - Intronic
1097786970 12:63771808-63771830 ATTCTTCAATAAAAGAGTCAAGG + Intergenic
1097813365 12:64043628-64043650 ATTTTCCAATCAACGAAATATGG - Intronic
1097994565 12:65873489-65873511 ATTTTAGAAAAAAAGAAAGAAGG + Intronic
1098096177 12:66958532-66958554 ATTCTCCAATAAAAGAAATGAGG - Intergenic
1098192142 12:67960700-67960722 ATTCCCCATTAAGAGAAAGTCGG - Intergenic
1098446192 12:70568300-70568322 TGTCTCCAAAAAAAGAAAGTGGG - Intronic
1098837897 12:75443407-75443429 ATTCTCCAATACTAAAAAGAAGG + Intergenic
1098952505 12:76655726-76655748 TATCTGCAAAAAAAGAAAGAGGG - Intergenic
1099123024 12:78716376-78716398 ATTATTAAATCAAAGAAAGATGG - Intergenic
1099231800 12:80035333-80035355 ATCCTCAAATAGCAGAAAGAGGG + Intergenic
1099435492 12:82637900-82637922 ATTCTTGAATAAAATGAAGATGG + Intergenic
1099478028 12:83132190-83132212 ATACTGCAACAAGAGAAAGAAGG - Exonic
1099572551 12:84342522-84342544 ATTCTTCAATAAAAGAACAGGGG - Intergenic
1099832832 12:87867166-87867188 ATTCTCCAATAAAAAGAACAAGG + Intergenic
1100361436 12:93883405-93883427 ATTATTCAGTAAAAGAAAGAAGG - Intronic
1100629987 12:96378502-96378524 ATTCTCCAGTAAAAGGAACCAGG - Intronic
1100752168 12:97710388-97710410 ATTCTCCAGTAAAAGAAGCAAGG + Intergenic
1101268064 12:103113091-103113113 CTTTTCCAAAAAAAAAAAGATGG - Intergenic
1101351906 12:103937861-103937883 ATTCAACACTAAAAGAATGAAGG + Intronic
1101525695 12:105527182-105527204 ATTCTCCAATAAAAGAAATCAGG - Intergenic
1102860725 12:116333984-116334006 TTTCTTTAATAAAAGAAAAAAGG - Intergenic
1102944588 12:116974814-116974836 GTTCTTCAATAAAAGGAACAAGG + Intronic
1102974381 12:117195849-117195871 ATTCTCCAAGAAAGGAAGAAGGG + Intergenic
1103030056 12:117606006-117606028 ATTCACCCATAAAAGGAAGAAGG + Intronic
1103315746 12:120053706-120053728 ATTCTCTAATAAATGAACGAAGG - Intronic
1104393529 12:128411638-128411660 ATTCTTCACTAAAAGAAACCAGG - Intronic
1104527342 12:129536695-129536717 ATATTCCAGTAATAGAAAGAGGG - Intronic
1105452628 13:20513794-20513816 ATTCTCCAGTAATAGGAAGCAGG + Intronic
1105675641 13:22668998-22669020 ATTTTCCAAAAAAAGTAACATGG + Intergenic
1105781389 13:23707627-23707649 ATTTTCTAATAAAATACAGAAGG + Intergenic
1105956834 13:25291270-25291292 ATTTTCCAATAAAAGGAACCAGG - Intergenic
1106064599 13:26333140-26333162 AGTCTCAAAAAAAAAAAAGAAGG - Intronic
1106285092 13:28311534-28311556 ATTTTCCAACAAAAAAAAGAAGG - Intronic
1106759613 13:32855959-32855981 ATTCTCCAGTAAAAGAACCAGGG + Intergenic
1107117125 13:36759229-36759251 ATTCTTCCTTAAAAAAAAGAAGG + Intergenic
1107326445 13:39248545-39248567 ATTCTGTAATAAAAGAAACCAGG + Intergenic
1107575053 13:41709619-41709641 ATTCTCCAGGCAAATAAAGAAGG - Intronic
1107756266 13:43625945-43625967 ATTCTCCAGTAAAACAAATAGGG + Intronic
1107784793 13:43944032-43944054 ATGTTCCAGAAAAAGAAAGAAGG + Intergenic
1107866424 13:44707690-44707712 ATTCTCCAATAAAAGGAAATAGG - Intergenic
1107870224 13:44739466-44739488 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1108005299 13:45940165-45940187 ATTCTCCACTAAAAGAAACAAGG + Intergenic
1108012597 13:46035037-46035059 ATTCTACAATAAAAGAAACCAGG + Intronic
1108331420 13:49388799-49388821 AATCTCCAAGAAAAGATGGATGG + Intronic
1108497206 13:51036733-51036755 ATTCTTTAATGTAAGAAAGAAGG + Intergenic
1108569987 13:51740242-51740264 GTTCTCCAACATGAGAAAGAAGG - Intronic
1108723341 13:53154789-53154811 ATTCACCAAAGAAGGAAAGAAGG + Intergenic
1109044047 13:57384830-57384852 ATATTCCAATAAAAGAAAATGGG - Intergenic
1109267716 13:60220123-60220145 ATTCTCCATTCAATGAGAGATGG - Intergenic
1109401825 13:61841319-61841341 ATTTTCAAAGTAAAGAAAGATGG + Intergenic
1109444935 13:62423721-62423743 TTTCTTCAATAATAAAAAGATGG + Intergenic
1109501749 13:63246129-63246151 ATTCTAGAATAGGAGAAAGAAGG - Intergenic
1109521558 13:63518564-63518586 ATTCTCCAATAAAAGGAATCAGG - Intergenic
1109814859 13:67567937-67567959 ATTCTCCAAAAAAAGAAACCAGG - Intergenic
1110058953 13:71016437-71016459 ATGGTTCCATAAAAGAAAGAAGG + Intergenic
1110432025 13:75435688-75435710 ATTCTCCACTAAAAGAATCTGGG + Intronic
1110478683 13:75948112-75948134 ATTCTCTAATAAAGGAAATCAGG - Intergenic
1110499315 13:76208276-76208298 ATTCAGAAAAAAAAGAAAGATGG + Intergenic
1110686166 13:78377105-78377127 ATTTTCCAATAAGGGAAACAAGG - Intergenic
1110844156 13:80174947-80174969 ATTCTCCAATAAAATGAACCAGG + Intergenic
1111024515 13:82502079-82502101 ATTCTAAAATTAAAGAAAGCAGG - Intergenic
1111200879 13:84934685-84934707 ATTACACAATAAAATAAAGAGGG + Intergenic
1111289348 13:86144008-86144030 ATACACCAATAATAGACAGAGGG + Intergenic
1111711974 13:91828523-91828545 ATTCTCCAATAAAAATAATGAGG + Intronic
1111961902 13:94820867-94820889 ATTGTTCAATAAAAAAGAGAAGG - Intergenic
1112143639 13:96673919-96673941 CTTCTCAAATGAAAGAAAGAGGG - Intronic
1112248298 13:97754444-97754466 ATGCTCCAAGCAAAGAAGGAAGG - Intergenic
1112871890 13:103982280-103982302 ATCCTCCAGTAAAAGAAACCAGG + Intergenic
1113878873 13:113611526-113611548 ATTCCCCAAGACAAGAAAAACGG - Intronic
1114169285 14:20255531-20255553 ATTCTCCAATAAAAGGTAGTAGG + Intergenic
1114341347 14:21748395-21748417 ATTATACAATAAAAGATAAAAGG - Intergenic
1114667105 14:24385003-24385025 ATTCTCCAATAAAGGAGCCAGGG + Intergenic
1114850087 14:26373294-26373316 GTCCTCCAATGAAAGAGAGAGGG - Intergenic
1114976839 14:28112355-28112377 ATTCTACAACAAAAGAAACTAGG + Intergenic
1115222668 14:31072885-31072907 GTTCTACAATAAAAGAAGAAAGG - Exonic
1115659350 14:35476567-35476589 CTTCTGAAATAAAAGAAAAAAGG - Intergenic
1115991892 14:39158436-39158458 CTCCTCCAAAAAAAGCAAGAGGG + Intronic
1116147709 14:41097063-41097085 ATTATCTAAGAAAAGAAAAAAGG + Intergenic
1116224911 14:42137864-42137886 ATTCTTCAATAAAATAAACTAGG - Intergenic
1116501619 14:45630957-45630979 ATTGTCCAATAAAATAAACCAGG + Intergenic
1116936943 14:50750221-50750243 ATTCTCCTATAAAAGGAACCAGG - Intronic
1117007293 14:51434311-51434333 ATTCTTCAATAAAAGGAACCAGG + Intergenic
1117015259 14:51511259-51511281 ACTTTCCAAAAAAAGAAAGATGG + Intronic
1117085727 14:52198334-52198356 ATTTTCCATTAAAAAAAAGGTGG - Intergenic
1117289326 14:54317071-54317093 ATTCTGCAACAGAAGGAAGAAGG + Intergenic
1117414558 14:55481730-55481752 ATTCTCCAATAAAGGGAATAGGG + Intergenic
1117661917 14:58015203-58015225 ATTCTCCACTGAAGGCAAGAAGG + Intronic
1117670922 14:58104731-58104753 ACTATCGAATAAAGGAAAGACGG + Intronic
1117940054 14:60953551-60953573 ATTATCAAATAGAAGATAGAGGG + Intronic
1117984266 14:61372195-61372217 ATTCTCCAACAAAAGGAACCAGG - Intronic
1118430606 14:65716382-65716404 ATTTTCCAAAAAAAAAAAAAAGG - Intronic
1118639342 14:67777788-67777810 ATTCTCAAACAAAACAAAGCTGG - Intronic
1118736252 14:68703757-68703779 ATACATCAATAAAAGAAAAAAGG + Intronic
1119028507 14:71173250-71173272 GTTCTCCAATAAAAGGAACTAGG - Intergenic
1119215099 14:72863523-72863545 ATTTCCCAATGAAAGCAAGAGGG - Intronic
1119504628 14:75161889-75161911 CTTCTCCAATAAAAGCAACCAGG + Intronic
1119631759 14:76238225-76238247 TGTCTCAAACAAAAGAAAGAAGG - Intronic
1119735946 14:76982153-76982175 ATTCTCCACTAAAAGGAACTAGG + Intergenic
1119900551 14:78255961-78255983 TTTTCCCATTAAAAGAAAGAAGG - Intronic
1120030946 14:79640074-79640096 TTTGTCCAATAAATGAAATAAGG + Intronic
1120225054 14:81781440-81781462 ATTCTTCAATAAAAGGACAAGGG - Intergenic
1120452474 14:84685688-84685710 ATTCTCTAATAAAAAGAATAGGG + Intergenic
1120562113 14:86007956-86007978 ATTTTTAAATGAAAGAAAGAGGG - Intergenic
1120699527 14:87683530-87683552 ATTCTCCACTAAAAGGACTAAGG + Intergenic
1120911960 14:89675064-89675086 ATTCTCAAATAAAAACCAGATGG - Intergenic
1120926882 14:89806114-89806136 ATTCTCCAGTCCAAGAAAAAAGG + Intronic
1120985019 14:90327132-90327154 ATTTTCCACTAAAAGAAACCAGG + Intronic
1121567121 14:94918454-94918476 ATTTACCAAAAAAAAAAAGACGG + Intergenic
1121579137 14:95013623-95013645 ATTCCCCAAAAAAGGCAAGATGG - Intergenic
1121695137 14:95906152-95906174 ATTCTCCAATAAAATGAACCAGG - Intergenic
1121934348 14:98003424-98003446 ATACACCAATAACAGACAGAGGG + Intergenic
1122361110 14:101164931-101164953 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1122818609 14:104328152-104328174 ATTTTCCACTAAAGGAAACAGGG - Intergenic
1123764840 15:23467717-23467739 TTTCTGCAATAAAAAAAAGTAGG - Intergenic
1123812129 15:23938162-23938184 ATTTTCCAATAAAAGGAACTAGG - Intergenic
1123851262 15:24359541-24359563 ATTCTCCAACAAAAAAGATAGGG - Intergenic
1123900311 15:24870220-24870242 ATTTTCCAATAAAAGAAACTAGG - Intronic
1123929394 15:25155000-25155022 ATTCTCCAATAGAACAAATCAGG + Intergenic
1124054961 15:26233804-26233826 ATTTTCCAATAATAGACAAATGG - Intergenic
1124080752 15:26492785-26492807 ATTCTCCAACAGAAGAAACTGGG + Intergenic
1124181961 15:27484608-27484630 ATTCTCCAATTAAAGGAACCAGG + Intronic
1124350417 15:28951423-28951445 ATTCTTCAATAAAATAAGGCAGG - Intronic
1124443745 15:29709842-29709864 AATCAGCAAGAAAAGAAAGAAGG + Intronic
1124534049 15:30529121-30529143 ATTCTCCAATATCAGAACCAGGG - Intergenic
1124764598 15:32478489-32478511 ATTCTCCAATATCAGAACCAGGG + Intergenic
1124987027 15:34629938-34629960 ATTCTCCAATAAAAATAATGAGG + Intergenic
1125061868 15:35435607-35435629 ATGCTCTCAGAAAAGAAAGAGGG - Intronic
1125109227 15:36011407-36011429 TTTCTCCAATACAAGCAATAAGG + Intergenic
1125479125 15:40068611-40068633 ATTATCCATTAAAAAAAATAGGG - Intergenic
1126293632 15:47111382-47111404 AGTTTCCATTAAAAGAAAGAAGG - Intergenic
1126320166 15:47413485-47413507 TGTCTCAAAAAAAAGAAAGAAGG - Intronic
1126605501 15:50472200-50472222 ATTCTACAATCAAAGCATGATGG - Intronic
1126624175 15:50670223-50670245 ATTCTCTTATAAAAGAAGGGGGG + Intronic
1126944426 15:53803318-53803340 ATTCTCCAGTGAAAGGAAGTAGG + Intergenic
1127029201 15:54843009-54843031 ATTCCCTTATAAAAGTAAGAAGG - Intergenic
1127034303 15:54897995-54898017 ATTCTCCAATCAAATCAGGATGG + Intergenic
1127042947 15:54997357-54997379 ATTTTCCTAAAAAGGAAAGAAGG + Intergenic
1127125836 15:55811183-55811205 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1127273280 15:57420199-57420221 GTTCTCCAATAAAAGGAAGCAGG - Intronic
1127443731 15:59038624-59038646 ATTCTCCAGGAAAAAAAAGAGGG - Intronic
1127465678 15:59242237-59242259 ATTCTTCAATAAAAAGAACAAGG + Intronic
1127523235 15:59764574-59764596 ATTCTCCACTAAAAGAAACTGGG - Intergenic
1127730374 15:61796092-61796114 ACTCTCCAATAAAAGGAACCAGG - Intergenic
1127777262 15:62274592-62274614 ATTTTAAAATAAAAGGAAGATGG - Intergenic
1127821551 15:62661163-62661185 CTTCTCCAATAAAATATAGAAGG - Intronic
1127865252 15:63027445-63027467 ATTCTCCAAAAAAAAAAAAAAGG + Intergenic
1127946633 15:63762051-63762073 ATTTTCCAATAAAAGAAACCAGG + Intronic
1128125385 15:65188589-65188611 ATTCTTAAGTAAAGGAAAGATGG - Intergenic
1128394165 15:67206856-67206878 ATTCTCCAATAAAAGGAACTAGG - Intronic
1128533794 15:68474564-68474586 ATTCCCCAATGAAAGAAACCAGG + Intergenic
1128626172 15:69206755-69206777 ATTCTCCAACACAAGAAACCAGG - Intronic
1128867465 15:71125563-71125585 ATTCTCCAGTAAGGGAAAGCTGG - Intronic
1128976799 15:72160285-72160307 ATTTTCCTAAAAAAAAAAGACGG + Exonic
1130119147 15:81031882-81031904 ATGCTCAAAGGAAAGAAAGATGG + Intronic
1130160235 15:81391319-81391341 ATTCTCCAATAAAAGAACCAGGG + Intergenic
1130413815 15:83671264-83671286 ACTTGCCAATAAAATAAAGAGGG + Intronic
1130729706 15:86478427-86478449 ATACACCAATAAGAGAAAAACGG + Intronic
1130783250 15:87067934-87067956 ATTCTCAAATGAAAGTAATATGG + Intergenic
1131580786 15:93640828-93640850 GTTCCCTAATAACAGAAAGAGGG - Intergenic
1131601518 15:93853893-93853915 ATTCTGCAATAATACAAGGATGG + Intergenic
1131753303 15:95533363-95533385 ATTCTCCAATAAAAAGAATCAGG + Intergenic
1132176391 15:99718779-99718801 ATTCTCCAATAAAGGGAACCAGG - Intronic
1133106822 16:3516792-3516814 ATTCTCCACTAAAAGGAACCAGG + Intronic
1133485798 16:6217296-6217318 ATGCTCCAATAAAGGAAATACGG - Intronic
1133502902 16:6382332-6382354 ATTGTGGAAGAAAAGAAAGAAGG + Intronic
1133976822 16:10605137-10605159 AATCTCCAGTTAAAGAAAGGTGG - Intergenic
1134139310 16:11703700-11703722 ATTCTCCAGTAAAAGAAACCAGG + Intronic
1134324552 16:13195157-13195179 ATTCTCCAATAAAATGAACCAGG + Intronic
1134518247 16:14904354-14904376 ATTCTCCAGTAAAAGGAACCAGG + Intronic
1134705918 16:16303012-16303034 ATTCTCCAGTAAAAGGAACCAGG + Intergenic
1134914528 16:18058753-18058775 TTTGTCCAGTAAAAGGAAGAGGG + Intergenic
1134961622 16:18409098-18409120 ATTCTCCAGTAAAAGGAACCAGG - Intergenic
1134965922 16:18491701-18491723 ATTCTCCAGTAAAAGGAACCAGG - Intronic
1135013990 16:18908359-18908381 AGTCTCCAAAAAAAAAAAAAAGG + Intronic
1135555013 16:23428991-23429013 TGTCTCAAAAAAAAGAAAGATGG - Intronic
1136331153 16:29577655-29577677 AGTCTCCAAAAAAAAAAAAAAGG + Intergenic
1137959630 16:52869322-52869344 ATTGTCCCATAGAACAAAGAGGG + Intergenic
1138129120 16:54464116-54464138 ATTCTCCAATAAATGGAATCAGG + Intergenic
1138190803 16:55012440-55012462 TTTCTCCAGCAAGAGAAAGAAGG - Intergenic
1138653692 16:58477300-58477322 ATTCTCCAATAAAGGGAACTAGG + Intronic
1138780909 16:59784605-59784627 ATTCTCCAATAAAAAGAATGAGG - Intergenic
1139123603 16:64050879-64050901 ATTCTACAATCAAAGTATGAGGG - Intergenic
1139255806 16:65541224-65541246 ATTCTCCAATAAAACAAACCAGG - Intergenic
1139314603 16:66057623-66057645 CTTCCCCAATAAAAGATATAAGG - Intergenic
1140029328 16:71322390-71322412 ATTTTCCAATAAAAGGAACCAGG + Intergenic
1140350459 16:74257542-74257564 ATTATCCAGGAAAAGAAAAATGG + Intergenic
1140973490 16:80036452-80036474 AATCTCCAATAAAAGAATCTGGG + Intergenic
1141047215 16:80726648-80726670 ATTCTCCAATAAAAGGAGCAAGG + Intronic
1141146777 16:81536573-81536595 ATTCTGCATTTATAGAAAGAAGG - Intronic
1141691234 16:85597773-85597795 ATTCTTCAATAACTAAAAGATGG + Intergenic
1141779120 16:86146284-86146306 ATTCTCCAATAACAGAAACTAGG - Intergenic
1142158727 16:88546274-88546296 ACTCTCCAATCAAAGGCAGAGGG + Intergenic
1142442982 16:90113095-90113117 ATTCTCTAACAAAAGAAATCAGG - Intergenic
1142464724 17:128295-128317 ATTCTCTAACAAAAGAAATCAGG + Intergenic
1142506680 17:368435-368457 ATTCTCCAATAAAAAGAGCATGG - Intronic
1143073761 17:4321494-4321516 TGTCTCCAAAAAAAGAAAGAAGG - Intronic
1143313260 17:6011126-6011148 ATTCTCCAATAAAAGAAACCAGG - Intronic
1143656553 17:8297404-8297426 ATTTGCCAATAAAAGAAAATAGG - Intergenic
1143936198 17:10486604-10486626 ATACTACATTAACAGAAAGAAGG - Intergenic
1144019200 17:11225055-11225077 ATTCTCCAATAAAAAGAACGTGG + Intergenic
1144248522 17:13392633-13392655 ATTCTCCAATAAAAGGAAACAGG - Intergenic
1144311384 17:14017236-14017258 ATTCCTCAATCAAAGAATGAAGG + Intergenic
1144824193 17:18096614-18096636 ATTCTCCAATCAAAGGAACCAGG - Intronic
1145213811 17:21036908-21036930 ATTCTCCCAAAAAAGAAACTAGG + Intronic
1146079706 17:29767732-29767754 ATACTCCTTTAAAAGAATGAGGG - Intronic
1146986131 17:37220253-37220275 ATCCTCAAATAAAAAAAAGTAGG + Intronic
1147149474 17:38505923-38505945 CGTCTCCAAAAAAAGAAAAAAGG + Intronic
1147366361 17:39961977-39961999 CTTCTCAAAAAAAAAAAAGATGG + Intergenic
1148118447 17:45192486-45192508 ACTCCTCAGTAAAAGAAAGAGGG - Intergenic
1148349901 17:46933630-46933652 ATTGTCCAAAAAAAAAAAAAAGG - Intronic
1148436755 17:47691573-47691595 CGTCTCAAAAAAAAGAAAGAAGG - Intergenic
1148716366 17:49718967-49718989 ACTCTCCAAAAAAAAAAAAAAGG + Intronic
1149239198 17:54629224-54629246 AGTCTCTAAGAAAAAAAAGAGGG - Intergenic
1149483723 17:57024478-57024500 GTTCTCTTATAAAAGGAAGAGGG - Intergenic
1149619155 17:58029147-58029169 ATTCTCCAATAAAAGAGCCAGGG + Intergenic
1149676302 17:58465618-58465640 TTTCTCCAAAAAAAAAAAAAAGG + Intronic
1150060396 17:62064505-62064527 ATGTTCTAATAAAAGCAAGATGG + Intronic
1150176252 17:63059873-63059895 ATTCTCCATTAAAAGAAACCCGG - Intronic
1151112600 17:71696672-71696694 ATACTTCAATAAAAGAAACTAGG + Intergenic
1151168910 17:72229178-72229200 ATTCAGCAATAAAAGAAATGAGG - Intergenic
1152397503 17:80043292-80043314 ATTTTCCACTAACAGAAACAGGG - Intronic
1153211081 18:2765788-2765810 ATTCTCCACTATAATAAAAAAGG - Intronic
1153234994 18:2977482-2977504 ATTCTCCAATAAAAGGAACCAGG + Intronic
1153668573 18:7388498-7388520 ACACTCTAATAGAAGAAAGAGGG + Intergenic
1153747243 18:8192328-8192350 ACTCCCCAATAAAAGAAACCAGG + Intronic
1153750546 18:8225509-8225531 ATTTTCCAGTAAAAGAAACCAGG - Intronic
1153823033 18:8848679-8848701 ATTCTGCAGAGAAAGAAAGAAGG + Intergenic
1154038104 18:10826137-10826159 ACTCTCCAATAAAAGGAACCAGG - Intronic
1155355359 18:24947135-24947157 ATTTTCAAACAAAAGAGAGATGG - Intergenic
1155461048 18:26084004-26084026 ATTCTCCAAAAAAAGAACCAGGG + Intronic
1155752964 18:29452592-29452614 ATTCTCCAATAAAAGGAAACAGG + Intergenic
1156148120 18:34211070-34211092 ACTCTCAAATAAAAGAAAGGAGG + Intronic
1156170022 18:34471633-34471655 ATTCTCCAATAAAAGGATCCAGG - Intergenic
1156565434 18:38183663-38183685 AATCTGGAATAAAATAAAGATGG + Intergenic
1156618847 18:38824281-38824303 ATTCTCCAATAAAAGAAATCAGG + Intergenic
1156914741 18:42452389-42452411 AGTATCCAAGTAAAGAAAGAAGG + Intergenic
1157063381 18:44319770-44319792 CTTCTCCAGGAAAATAAAGATGG - Intergenic
1157918089 18:51689163-51689185 ATTCTGCAATAAAAGGAACCAGG - Intergenic
1158334191 18:56397407-56397429 ATACTCCAATAAGAAAAATAGGG - Intergenic
1159061251 18:63516744-63516766 AATCACCAAAGAAAGAAAGAGGG + Intergenic
1159215386 18:65385446-65385468 ATTTTTCAATAAAAGAAATATGG + Intergenic
1159301441 18:66575619-66575641 AATCTTCAATAAAGGAAAGTGGG + Intronic
1159376553 18:67600765-67600787 TTCCTCCAGTAAAAAAAAGAAGG + Intergenic
1159641612 18:70869618-70869640 ATTCTCCAGTAAAAGAAACTAGG - Intergenic
1159819014 18:73116064-73116086 ATTCTCCAATAAAAATAATCAGG + Intergenic
1160002146 18:75035003-75035025 ATTCACTCATGAAAGAAAGATGG + Intronic
1160119674 18:76118756-76118778 ATACTCCAAGAACAGAAGGAAGG - Intergenic
1160380211 18:78448820-78448842 ATTCTCCAATAAAAGAAAGAGGG + Intergenic
1161211671 19:3069338-3069360 TGTCTCAAAAAAAAGAAAGAAGG + Intergenic
1161509130 19:4660943-4660965 ATTCTGGCACAAAAGAAAGAGGG - Intronic
1161598932 19:5168698-5168720 ATTCTCCAATAAAAGGAACCAGG + Intronic
1161675369 19:5644733-5644755 ATTCCCCAAACAAAGAAAGGGGG - Intronic
1161788012 19:6340274-6340296 TGTCTCCAAAAAAAGAAAGAAGG + Intergenic
1162212760 19:9105891-9105913 ATTCACAAAAAAAAGAGAGAAGG + Intergenic
1162295341 19:9809589-9809611 ATTTTCCAGAAACAGAAAGAAGG - Intergenic
1163165569 19:15495445-15495467 ATTTTCCAATCAAAGGAATAAGG - Intronic
1163440153 19:17318665-17318687 CGTCTCCAAAAAAAAAAAGAAGG - Intronic
1163520461 19:17788532-17788554 ATTTTCTAATAAAATAAAAAAGG + Exonic
1164253862 19:23510090-23510112 AGTCTCCAAGAAATGAAAGTTGG + Intergenic
1164518020 19:28952961-28952983 ATCCTCACATAATAGAAAGAAGG - Intergenic
1165103405 19:33454049-33454071 ATCCTCCAATAAAAGGAACCGGG + Intronic
1165168756 19:33875899-33875921 AATGTCCAATATAAGAGAGAGGG + Intergenic
1165286053 19:34842705-34842727 ATTATCACATAAAAGAAATAAGG + Intergenic
1166045498 19:40227482-40227504 ATTCTCCACTAAAAGGAACCAGG + Intergenic
925243843 2:2361106-2361128 ATTCTCCTATAAAAGAATCCAGG - Intergenic
925928910 2:8691956-8691978 ATCCTCCAGAAAAAGAAAAAGGG + Intergenic
926142518 2:10376441-10376463 AATCTCAAAAAAAAAAAAGAGGG - Intronic
926382839 2:12307721-12307743 ATTTTTCAAGAAAAGAAACATGG - Intergenic
926526009 2:13981818-13981840 ATTTTCCTCTAAAAGAAACAAGG + Intergenic
926555767 2:14356105-14356127 ATTCTCCAATAAAAGGAGCCAGG + Intergenic
926926154 2:17989705-17989727 ATTCTCCAATAAAAGGAAACAGG + Intronic
926974386 2:18499017-18499039 ATTTTCCAACAAAAGAATGTGGG + Intergenic
927363729 2:22269151-22269173 ATTCTCTAATAAAGGAAACTAGG - Intergenic
927406043 2:22768401-22768423 TTTCTACAATAGAAGGAAGAGGG + Intergenic
928376524 2:30778900-30778922 TTCCTCCAATGCAAGAAAGAGGG + Intronic
928455460 2:31416671-31416693 ATTCTGCCCTGAAAGAAAGAAGG + Intergenic
928560716 2:32482117-32482139 ATTCTCCTTTAAAAAAAAGTAGG - Intronic
928565554 2:32543833-32543855 GTTCTCCAGTAATAGAAACAAGG + Intronic
928574246 2:32638680-32638702 AGTATTCAATAGAAGAAAGAAGG - Intronic
928599296 2:32887439-32887461 ATTCTCTAGTAAAAGAAACCAGG + Intergenic
928793055 2:34981535-34981557 ATTCTGGAATAAAAGACAGCTGG + Intergenic
928839593 2:35588722-35588744 TTTCTCCAATTAAAAAAATACGG - Intergenic
928919262 2:36509523-36509545 TGTCTCCAACAAAAGAAAAAAGG + Intronic
929504557 2:42518253-42518275 ATTCTCCAATAAAAGGAACTAGG + Intronic
929623361 2:43380705-43380727 ATTCTCCAATAAAAGAAACCAGG + Intronic
929912601 2:46103348-46103370 ATTCTCCAATAAAAGAAGCCAGG - Intronic
929932218 2:46267087-46267109 ATTCTCCAATAAGAGATACCAGG + Intergenic
930021034 2:47002447-47002469 ATTTTCTAATGAAAGAAAGCAGG + Intronic
930215832 2:48696156-48696178 ATTCTCTATGAAAACAAAGATGG - Intronic
930267158 2:49213368-49213390 CTGTTCCAATAAAAAAAAGAGGG + Intergenic
930374000 2:50540972-50540994 GTTCTTAAATAAAAGAGAGAAGG + Intronic
931051570 2:58421117-58421139 ATTGGCCAGAAAAAGAAAGATGG + Intergenic
931199401 2:60082934-60082956 ATTGTCCAATAAAAGCAACCAGG + Intergenic
931593561 2:63914285-63914307 GTTCTACAAGAAAAGAAAAATGG + Exonic
931929149 2:67109257-67109279 ATTCTCCACTAAAGGAACCAGGG - Intergenic
932839666 2:75070362-75070384 ATTCTCCAATAAAAGGAACCAGG - Intronic
932875955 2:75452200-75452222 ATTCTCTAATAAAAGGATCAAGG - Intergenic
933163287 2:79050538-79050560 ATTTTCCAATAAAAGGAATCAGG + Intergenic
933215159 2:79621295-79621317 ATTCTCCAATAAAAGGAACCAGG + Intronic
933375162 2:81469757-81469779 ATTCTACAATAAAAGGAAGCAGG - Intergenic
933431760 2:82190403-82190425 TTTCTTCCAAAAAAGAAAGAAGG + Intergenic
933797925 2:85936296-85936318 ATCCTCCAATAAAAGAAACCAGG - Intergenic
933878327 2:86642778-86642800 ATTCTCCATTAAAGGAAACCAGG - Intronic
933947953 2:87303880-87303902 ATTCACCAATAAAACAAATCAGG + Intergenic
934371440 2:92749742-92749764 ATCTTCCAATAAAAGCTAGATGG + Intergenic
934471120 2:94537860-94537882 ATCTTCCAATAAAAAATAGAAGG - Intergenic
934772768 2:96918144-96918166 ATTCTAAAATAAAAAAAAAAAGG + Intronic
934876788 2:97929065-97929087 ATTTTCCAATAAAAGAAACCAGG + Intronic
934928543 2:98400099-98400121 TTTCTCCAATAAAAGGAACCAGG + Intergenic
935195128 2:100809245-100809267 CATCTCCAAAAAAAAAAAGATGG + Intergenic
935747378 2:106200434-106200456 ATTCTCCAATAAAAGAAAACAGG - Intergenic
935754569 2:106266948-106266970 ATTCTCCAAGAAGAGAAACCAGG + Intergenic
935918412 2:107984229-107984251 CTTATCCATGAAAAGAAAGAAGG - Intergenic
936113958 2:109687437-109687459 ATTCTCCAAGAAGAGAAACCAGG - Intergenic
936236944 2:110750448-110750470 GTTCTCAAATAAAAGAAACTAGG - Intronic
936332245 2:111557692-111557714 ATTCACCAATAAAACAAATCAGG - Intergenic
936378633 2:111964517-111964539 ATTCTCCAATAAATGGAACCAGG - Intronic
936388470 2:112052295-112052317 ATTCTCCACTAAAATAAACCAGG - Intergenic
937943562 2:127310322-127310344 ATTCTCCACTAAAAGGAACCAGG - Intronic
937951775 2:127393768-127393790 ATTCTCCAACAAAAGAAACCAGG - Intergenic
938608044 2:132916602-132916624 AATGTCCATTAATAGAAAGATGG - Intronic
938714173 2:134003995-134004017 ATTCTCCAGCAAAAGGAAAATGG + Intergenic
939202146 2:139050873-139050895 ATTTTTCGATAACAGAAAGAGGG - Intergenic
939283557 2:140098668-140098690 ATTCTCCCAGGAAAAAAAGAAGG + Intergenic
939702392 2:145409765-145409787 ATTGTACAATTAAAGAAAGTTGG + Intergenic
940213915 2:151284979-151285001 ATTCTTCAATAAAAGAAACCAGG + Intronic
940388504 2:153103267-153103289 ATACTTCAAGAACAGAAAGAAGG - Intergenic
940604845 2:155908730-155908752 ACTCACCAAAAAGAGAAAGAAGG + Intergenic
940798819 2:158109850-158109872 ATTCTCCACTCAAACAAAGCAGG + Intronic
941007823 2:160265528-160265550 ATTCTCCATCAAAAGAAACTAGG + Intronic
941064072 2:160880952-160880974 TTTCTCCAATAAAAGGAACCAGG - Intergenic
941194321 2:162428350-162428372 AATCAACAATAAAAGAAAGAAGG - Intronic
941200258 2:162499500-162499522 TTTCTCCAAATAAATAAAGAAGG + Intronic
941469500 2:165866896-165866918 ATTCTACTACAAAAAAAAGAGGG + Intronic
941544193 2:166827068-166827090 ATTCTCCAAGAAAAGGAACCAGG + Intergenic
941599662 2:167526072-167526094 ATTCTCCAATAAAGGGAACCAGG - Intergenic
941718578 2:168789050-168789072 ATTCTCCACTAAAGGAACCAGGG + Intronic
942069452 2:172303213-172303235 ACTCTACTATAAAAGAAAGAAGG - Intergenic
942233946 2:173886050-173886072 ATTCTCCAATAAAAGGAACTGGG + Intergenic
942464689 2:176195366-176195388 ATTCTCCTATAAAACAAAGTGGG + Intergenic
942493541 2:176514230-176514252 ATTCTACAAAAAATGAAAGTGGG - Intergenic
942677464 2:178443497-178443519 ATTCTGCAACAGAAAAAAGAGGG + Intronic
942957760 2:181794047-181794069 ATTCTGCAATAAAAGGAATGAGG + Intergenic
943118758 2:183708236-183708258 ATGAACCAATAAAAGAAAAAAGG - Intergenic
943636758 2:190315542-190315564 ATTATCCAATAAAACAAACATGG + Intronic
943747610 2:191478781-191478803 ATTCTTCACAAAAAGCAAGATGG - Intergenic
944008189 2:194937776-194937798 ATTCTCCAACAAAAGGCACAAGG + Intergenic
944081066 2:195789029-195789051 ATTCTCCATTAAAAGGAAATGGG + Intronic
944169793 2:196762024-196762046 ATGCTAAATTAAAAGAAAGATGG + Intronic
944241296 2:197487661-197487683 ATACTCCACTAAAAGGAAGCAGG - Intronic
944332661 2:198489870-198489892 ATTCTCCAATAAAATAAACCAGG - Intronic
944823028 2:203450515-203450537 ATTCTTCTATAAAAGGAGGAAGG + Intronic
944889198 2:204099353-204099375 ATTCTCCAGTATAACAAAAACGG - Intergenic
944903909 2:204243716-204243738 ATTCTCCAAAAGAAAAGAGATGG + Intergenic
944914586 2:204345177-204345199 ATTCTTCAATAAAAGGAACCAGG + Intergenic
945204885 2:207320778-207320800 ATCCTCCAATAAAAGGAAACAGG + Intergenic
945688062 2:212996804-212996826 ATTCTGCAATGAAAGAACTAAGG + Intergenic
945721754 2:213425854-213425876 ATGCTCCAATAATAGAAAACAGG + Intronic
946127488 2:217576544-217576566 ATTATCCAACAAAAGAAACCAGG + Intronic
946193498 2:218020099-218020121 ATGCTTCAATAATAGAAAAAAGG - Intergenic
946258967 2:218469244-218469266 TTTCTCCAATAATAGAAGAAAGG - Intronic
946482112 2:220067134-220067156 ATACACCAATAAAATAAAGTGGG - Intergenic
947022431 2:225694830-225694852 ATTGCCCAATACATGAAAGATGG - Intergenic
947309206 2:228781992-228782014 ATTCTCAAAAAAAAAAAAAAAGG - Intergenic
948507577 2:238440195-238440217 ATTCTTCACTAAAAGAAACCAGG - Intronic
948591983 2:239056296-239056318 ATTCTCCAATGAAGGGAAGCAGG + Intronic
948816993 2:240516117-240516139 ATTCTCCAATCAAAGAGTAAAGG + Intronic
1169238388 20:3951955-3951977 TTTCTCCAATAAAAGGAATTAGG - Intronic
1169553149 20:6721935-6721957 ATTTTCCTATAAAATAAAGATGG - Intergenic
1169629803 20:7617998-7618020 ATTCTCCAATAACAGGAAGCAGG + Intergenic
1169634096 20:7667633-7667655 ATTTGCCAAGAAAGGAAAGAAGG + Intergenic
1170115843 20:12858664-12858686 ACTCTCTAATAAAAGGGAGAAGG + Intergenic
1170383253 20:15785374-15785396 ATTCTCCAAGAGAATCAAGACGG - Intronic
1170924404 20:20709864-20709886 ATTATCAAAAATAAGAAAGACGG + Intronic
1171104360 20:22418402-22418424 ATTCTCCAATAAAAGGAACCAGG + Intergenic
1171199013 20:23226231-23226253 ATTCTTCAAAGAAAGAATGAAGG + Intergenic
1171368357 20:24642808-24642830 ATTCTCTAATGAAAGAACCAGGG - Intronic
1171535742 20:25887265-25887287 AGTTTCCATTAAAAGAAAGAGGG + Intergenic
1171572116 20:26262633-26262655 AGTTTCCATTAAAAGAAAGAGGG - Intergenic
1171805347 20:29673919-29673941 AGTTTCCATTAAAAGAAACAGGG - Intergenic
1171838703 20:30182511-30182533 AGTTTCCATTAAAAGAAAGATGG + Intergenic
1171991299 20:31698542-31698564 CGTCTCCAAAAAAAAAAAGAAGG - Intronic
1172142594 20:32733876-32733898 CTTCTCAAAAAAAAAAAAGAAGG + Intronic
1172757043 20:37292852-37292874 ATTCTCCAATAAAAGGAGCCAGG - Intronic
1172892318 20:38275113-38275135 ATTCTCCAGTAAAAGAAAACAGG + Intronic
1172985209 20:38981615-38981637 ATTCTCCAATAAAAGGAACCAGG - Intronic
1173268874 20:41513312-41513334 CTCCTCCAATAAAACAAGGATGG + Intronic
1173345888 20:42199501-42199523 ATTCTCCAGAAAAAGAATCAAGG + Intronic
1173783235 20:45773817-45773839 ATTCTCCAATAAAAGAAAGAAGG + Intronic
1173783253 20:45773938-45773960 ATTCTCCAATAAAAGAAAGAAGG + Intronic
1173996446 20:47342237-47342259 ATTCTCCAATAAAAGAAACCAGG + Intronic
1174273837 20:49389090-49389112 ATTCATCAAAGAAAGAAAGAAGG + Intronic
1174643277 20:52063608-52063630 ATTCTCCAATTAAAGAAACTGGG + Intronic
1175076515 20:56379564-56379586 ATTCTCCAAGAAAAGGAAACAGG + Intronic
1175096906 20:56548440-56548462 ATTCTCCAAGAAAAGGAACCTGG - Intergenic
1175418116 20:58815146-58815168 ATTCTCCCATAAAAGGAACCAGG - Intergenic
1175649437 20:60705491-60705513 ATTCTCCAATGAAAGGAAGTAGG - Intergenic
1175673223 20:60924212-60924234 ACTCTCCAATAAAAGTAACCAGG - Intergenic
1176931662 21:14819481-14819503 ATTTGCCAATGAGAGAAAGAAGG - Intergenic
1177064589 21:16413808-16413830 ATTCTCCAATCAAAGACACTAGG - Intergenic
1177824097 21:26063431-26063453 ACTCTCCAATAAAAGGAACAAGG + Intronic
1177851482 21:26354154-26354176 ATTTTCCAATAAAAGGAACAAGG + Intergenic
1178127691 21:29533286-29533308 ACTCTCCCAAAAAAGAAAAATGG + Intronic
1178415227 21:32399205-32399227 TGTCTCAAAAAAAAGAAAGAAGG + Intergenic
1178416180 21:32406898-32406920 AGTCTCCAAAAAAAAAAAAAGGG - Intergenic
1178630414 21:34254827-34254849 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1178708468 21:34892961-34892983 ATTCTGAAATAACAGAAAGTAGG + Exonic
1179371724 21:40811994-40812016 ACTCTCCAATACCAGGAAGATGG - Intronic
1179521082 21:41945399-41945421 CTTCTCCAATAAAAGGAATCAGG + Intronic
1179637074 21:42719670-42719692 ATGCTCCTATAAAAGAACGAAGG - Intronic
1180116685 21:45711115-45711137 ATTCTCCAATAAAAGGAACCAGG - Intronic
1180568207 22:16693111-16693133 ATTTTCTAAGATAAGAAAGACGG + Intergenic
1181134554 22:20755414-20755436 ATTCTCCAATAAAAGGAACCAGG - Intronic
1182660925 22:31924623-31924645 TTTCAAAAATAAAAGAAAGAAGG + Intergenic
1182954677 22:34411547-34411569 ATTCTCCAATAAAAAGAACCAGG + Intergenic
1183558162 22:38547837-38547859 ATTGACCAATGAAAGGAAGAAGG - Intronic
1202724591 2_KI270715v1_random:137307-137329 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202724759 2_KI270715v1_random:140026-140048 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202724927 2_KI270715v1_random:142745-142767 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202732849 2_KI270716v1_random:101271-101293 ATCTTCCAATAAAAGCTAGATGG + Intergenic
949146217 3:703059-703081 ATTATCCAAAAAAAGATATATGG - Intergenic
949697802 3:6719516-6719538 ATTCTCCAATAAAAGGAACCTGG + Intergenic
950236939 3:11330610-11330632 ATTCTCCAAGAAAATAAATCGGG - Intronic
950402821 3:12783304-12783326 ATTCTCCAGTAAAAGGAACCAGG + Intergenic
950409043 3:12822707-12822729 ATTCTCCACTAAAAGGAATCAGG - Intronic
951091833 3:18583081-18583103 ATTCACCAATAAAAGGAATCAGG + Intergenic
951346818 3:21556964-21556986 ATACACCAATAACAGACAGAGGG - Intronic
951571720 3:24071136-24071158 ATACTCAAAAAAAAAAAAGAAGG - Intergenic
951631000 3:24720125-24720147 CTTCTTCAAAACAAGAAAGAGGG + Intergenic
951724278 3:25739260-25739282 AATTTCCTATAAAAGACAGATGG + Intronic
951765739 3:26196461-26196483 TATCTCCCATAAAAGAAAGTAGG + Intergenic
951781558 3:26369068-26369090 ACCTTCCAATAACAGAAAGAAGG - Intergenic
952014954 3:28945418-28945440 ATTCTCCAATACAAGGAATCAGG - Intergenic
952280792 3:31921329-31921351 ATTCTCCAATAAAAGGAGTCAGG + Intronic
952687040 3:36162075-36162097 TTTCTCCAATGAAGGAAAGGAGG + Intergenic
952733943 3:36669232-36669254 ATTCTCCAATAATAGGAACCAGG + Intergenic
952864742 3:37846767-37846789 ATTCTCCACTAAAAAGAAGCAGG + Intergenic
952952442 3:38536081-38536103 ATTCTCCATTAAAAGGAACCAGG - Intronic
953117325 3:40006080-40006102 ATTTTCAAAGAAAAGAAAGAAGG + Intronic
953648669 3:44779304-44779326 ATGCTCCAATAAAAGGAATTAGG - Intronic
953674264 3:44988100-44988122 ATTCCCCAATAAAAGCAACCAGG + Intronic
954046991 3:47940529-47940551 ATTCTCCTATAAAAGTAGAATGG + Intronic
954203037 3:49036346-49036368 ATTCCCCAATAAAAGGAACCAGG + Intronic
954315170 3:49797280-49797302 TGTCTCAAAAAAAAGAAAGAAGG - Intronic
954404071 3:50335617-50335639 TGTCTCAAAAAAAAGAAAGAAGG - Intronic
954609121 3:51934978-51935000 ATTCTAAAAAAAAAGAAAAAAGG + Intronic
954862516 3:53702644-53702666 ATTCTCAAAGGAAAGAGAGAAGG + Exonic
955342628 3:58137183-58137205 TTTCTCCATTCAAAAAAAGATGG - Intronic
957118121 3:76053730-76053752 AGTCTCCAAAATAAAAAAGATGG - Intronic
957712714 3:83884062-83884084 ATACTGAAATAAAAGAAAAAAGG + Intergenic
957817869 3:85325873-85325895 ATTCTTATATAAAAGAAACAGGG + Intronic
957837436 3:85615603-85615625 TTTCCCTAATAAAAGAAATAAGG - Intronic
957883488 3:86253088-86253110 ATTAACCAATAAAAGAAAAGTGG - Intergenic
958717866 3:97808771-97808793 ATTCTCCACTAAAAAGAAGTAGG + Intergenic
958786920 3:98606486-98606508 ATTCCAGAATAAAAGAAAAAAGG - Intergenic
958918102 3:100072076-100072098 ATTCTTCCAGAAGAGAAAGATGG + Intronic
958982040 3:100732734-100732756 ATTCTTCAATTAAAGAAAGAAGG - Intronic
959190887 3:103109514-103109536 TTTTACCAGTAAAAGAAAGAGGG - Intergenic
959574181 3:107916761-107916783 ATTCTCCAATAAAAGAACTGTGG + Intergenic
959607116 3:108253346-108253368 TTTCTCCAATAAAAGAAACAGGG - Intergenic
959655269 3:108797137-108797159 ATTCTCCAATAAAAGGAACCAGG + Intergenic
960081232 3:113542764-113542786 AATCTCCATAAAATGAAAGAAGG - Intronic
960312148 3:116129992-116130014 ATTCTGCAATAAAAGAATATTGG - Intronic
960432886 3:117591294-117591316 ATTCTCCAATAAAATAAGCTAGG - Intergenic
960821296 3:121735866-121735888 AATCTCCAATAAAAGGAACTAGG + Intronic
960880180 3:122336198-122336220 GTTCTCCAATAAAAGGAGCAGGG + Intronic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
962428107 3:135292472-135292494 ATTCTCCAGTAAAAAGAACAGGG + Intergenic
962683626 3:137825138-137825160 GTTGTTGAATAAAAGAAAGAAGG + Intergenic
962824427 3:139087642-139087664 AATTTCCATTAAAAGAAGGAGGG + Intronic
962884048 3:139607024-139607046 ATTCTTCAATAAAAGAAACCAGG - Intronic
963013007 3:140792308-140792330 ATTATCCAATAAAACATATAGGG + Intergenic
963807791 3:149743283-149743305 ATTCTCCATTAAAAGGAACCAGG + Intronic
963933266 3:151026316-151026338 ATTCTCCAATAAAAGGAACCAGG - Intergenic
963945054 3:151136557-151136579 ATTCTCCAATAGAAGGAATGGGG + Intronic
964180827 3:153883080-153883102 ATTCTCCAATAAAAAGAACCAGG - Intergenic
964240642 3:154589635-154589657 ATTCCTCAATAAAATAAATATGG - Intergenic
964459530 3:156908691-156908713 ATTCTCCAATTAAAGAAATCAGG - Intronic
964840795 3:160991354-160991376 ATTCTCAGGAAAAAGAAAGATGG + Intronic
964875588 3:161364878-161364900 ATGATTCAAAAAAAGAAAGAAGG - Intronic
965238842 3:166165791-166165813 ATTTGCCAATAAAAGAACAAAGG - Intergenic
965353290 3:167642692-167642714 ATTCTCCAATAAATGGAACTGGG + Intronic
965407298 3:168286044-168286066 AGTCTCCAAGAATAGAAAGGAGG + Intergenic
965651784 3:170941637-170941659 ATTCTCTAATAAAAGGAATCAGG + Intergenic
965998920 3:174923039-174923061 ATTCTACAAAAAAAGGAACAAGG + Intronic
966264708 3:178025697-178025719 ATTGTGCATTGAAAGAAAGATGG + Intergenic
966504738 3:180686908-180686930 ATTCTCCCATAAAAGGAACCAGG - Intronic
966764560 3:183448155-183448177 ATTCTCCAAAAAAAGGAACCAGG - Intergenic
967801570 3:193667918-193667940 ATTCTTCAAAAAAAGGAAGCTGG - Intronic
967919304 3:194602597-194602619 CTTCTCAAAAAAAAAAAAGAAGG + Intronic
968363252 3:198164057-198164079 ATTCTCTAACAAAAGAAATCAGG - Intergenic
969271958 4:6109036-6109058 ATTCTCCAATAAAAGGAACCAGG + Intronic
969611609 4:8230458-8230480 ACTGACCAAGAAAAGAAAGATGG - Intronic
969991955 4:11273981-11274003 ATTCTCCTATACAAACAAGAGGG + Intergenic
970152671 4:13106466-13106488 ATTTTCCAATATAAGAAATGTGG + Intergenic
970181782 4:13405206-13405228 ATACCCCAGTAAAAGAAAGAAGG - Intronic
970475614 4:16419254-16419276 ATTCTCCAGTGGAGGAAAGAAGG - Intergenic
971164435 4:24168494-24168516 ATTCTCCAATAAAAGGAATCAGG + Intergenic
971521623 4:27559663-27559685 ATACTCAAATAAAATAAAAATGG + Intergenic
971535327 4:27740658-27740680 ATTCTTCAATAAAGTAAAAATGG - Intergenic
971541937 4:27829176-27829198 ATTCTCTAATGAAAGCATGAAGG - Intergenic
971604198 4:28636431-28636453 ATTATTCAATAAGATAAAGATGG - Intergenic
971678944 4:29672003-29672025 ATTGGCCAATTAAAGAAACAGGG + Intergenic
971707170 4:30059857-30059879 ATTCTCCAAGAAAAGTTAGAAGG + Intergenic
971975607 4:33682447-33682469 ATTCTCCTCAAAAAGAAAGTGGG - Intergenic
972261978 4:37418058-37418080 ATTCTCTAATAAAAGGAATAAGG + Intronic
972281385 4:37605343-37605365 ATTGTCCAATAAAAGGAACCAGG + Intronic
972469144 4:39386830-39386852 ATTCTCCAATAAAAGGAACTTGG + Intergenic
973153599 4:46919655-46919677 ATTATTCAAGAGAAGAAAGAAGG + Exonic
973153963 4:46924962-46924984 ATTCTCCAGTAAAAGACACCAGG - Exonic
973565292 4:52180406-52180428 ATTCTCCAATAAATGGAACCAGG + Intergenic
973664901 4:53149193-53149215 ATTCTCCAATAAAAGGAAACAGG + Intronic
974149668 4:57990503-57990525 ATTTTCAAAAAAAAAAAAGAAGG - Intergenic
974548340 4:63341340-63341362 ATCCTGCAATAAAAACAAGAAGG - Intergenic
974980440 4:68949948-68949970 ATTTTCCAATAAACAAAAGTGGG - Intronic
975128774 4:70811593-70811615 ATTCTCCAAGAAAAGGAATCAGG + Intergenic
975463692 4:74685376-74685398 ATTTTACAATAATAAAAAGAAGG + Intergenic
975509475 4:75177871-75177893 ATTCTCCACTAAAAGAATCTGGG - Intergenic
975953163 4:79800135-79800157 ATTCTGCAATAAAACATAGAAGG + Intergenic
976212840 4:82689133-82689155 ATTCTCCACTAAAAGGAATCAGG + Intronic
976363547 4:84207941-84207963 ATACACCAATAATAGAAAAACGG + Intergenic
976532015 4:86166313-86166335 ATTCTACAACTAAAGAAACAAGG - Intronic
976979569 4:91209974-91209996 ATTCTCTACTAAAATAAACAAGG + Intronic
976982446 4:91247565-91247587 ATTCTCCAATGAAAGGAACCAGG + Intronic
977137693 4:93326502-93326524 ATTCTCCAATAGAGAATAGAAGG + Intronic
977372299 4:96154319-96154341 AGTCTCTAATAAAAGAAAACGGG + Intergenic
978008206 4:103645614-103645636 ATTCTTAATTAAAAGAAAAAAGG + Intronic
978091403 4:104721087-104721109 ATTCTCTAATAAAAGCAATCAGG + Intergenic
978147940 4:105399048-105399070 ATTCTCCATTAAAAGCAAACTGG + Exonic
978152868 4:105457887-105457909 ATTCTCCAATAAAAGGAACTAGG + Intronic
978182102 4:105811174-105811196 ATTCTCCAAAAAAATAGAAAAGG + Intronic
978193557 4:105944068-105944090 ATTGTCCATTTAAAGAAAGATGG + Intronic
978410901 4:108424338-108424360 CTTCTCCAATAAAAGGAACCAGG + Intergenic
978530804 4:109711336-109711358 ATTCTCCAACAAAAGGAACCAGG + Exonic
978614809 4:110583975-110583997 ATTCTCCCATAAAAGAAACCAGG + Intergenic
978927845 4:114271137-114271159 ATTTTCAGTTAAAAGAAAGAAGG + Intergenic
979388697 4:120100764-120100786 ATCCTTCAAGAAAAGGAAGAAGG - Intergenic
979414494 4:120419552-120419574 ATACACCAATAACAGAAAAATGG - Intergenic
979493018 4:121351078-121351100 CATGTACAATAAAAGAAAGAAGG + Intronic
979714267 4:123818466-123818488 ATTCTCCAAAAGCAGAAAAAAGG - Intergenic
980437263 4:132793547-132793569 ATTCTTTACGAAAAGAAAGAGGG + Intergenic
980608956 4:135131582-135131604 AGTCACCAATAAAAGAAACCAGG - Intergenic
980987722 4:139711800-139711822 GTTCTCTTATAAAAGAAAGGGGG - Intronic
981058556 4:140394252-140394274 ATTCTGCAAGAAAAGGAAAAGGG + Intronic
981152109 4:141391187-141391209 ATTCTCTAATAAAAGGAACCAGG - Intergenic
981284657 4:143002046-143002068 ATTCTCCAATAAAAGGAATAAGG + Intergenic
981294843 4:143119850-143119872 TTTCTCAAAGAAAAAAAAGAGGG - Intergenic
981492846 4:145358913-145358935 ATTCTCCGATAAAAAAACAAGGG + Intergenic
981567837 4:146119315-146119337 ATTCTTCAATAAAAGGAACTAGG + Intergenic
981638240 4:146905723-146905745 ATTCTACAATAAAATAAATTTGG + Intronic
982161208 4:152571578-152571600 ATTTTCCAATAAAAGAAATTAGG - Intergenic
982467443 4:155748148-155748170 ATTCTCCCTTAAACTAAAGATGG - Intergenic
982816358 4:159890146-159890168 ATTTTCCAATAAAAGAAACCAGG - Intergenic
983048651 4:163017709-163017731 ATTCTCCAATGAAAGAAACCAGG + Intergenic
983092806 4:163524899-163524921 ATACTGCATTAAAACAAAGAAGG - Exonic
983111602 4:163756998-163757020 AGTCTTCAATACAACAAAGATGG - Intronic
983119504 4:163863721-163863743 ATTCTCCAGTAAAAGGAACCAGG + Intronic
983232562 4:165143827-165143849 TTTCTCCAATAATAGAATTAGGG + Intronic
983356917 4:166674125-166674147 ATTTTCCAACAAAATAAAAATGG - Intergenic
983395497 4:167189040-167189062 CTTCTCAAATAAAGAAAAGAAGG + Intronic
983513666 4:168635046-168635068 TCTCTCCAATAACTGAAAGAAGG + Intronic
983728028 4:170954180-170954202 ATTATCCAATAAAAGAAAATAGG - Intergenic
983798408 4:171895815-171895837 CTTCTCCACTTAATGAAAGATGG + Intronic
984281550 4:177676980-177677002 ATTCTTCCATGAAAGAAAAATGG + Intergenic
984398529 4:179230663-179230685 CTTCTTTAATAAGAGAAAGATGG - Intergenic
984611297 4:181842252-181842274 ATTATCCAAGAAAATCAAGAGGG + Intergenic
984732890 4:183084866-183084888 ATTCTCTAATAAAAGAAATCAGG - Intergenic
984891199 4:184494940-184494962 ATTCTCCAACAAAAGGAACCAGG + Intergenic
984950829 4:185006403-185006425 ACTGTCCAAAAAAAGAAAAAAGG - Intergenic
985810635 5:2081753-2081775 ATTCTCCAGTAAAAGGAACCAGG + Intergenic
986080099 5:4382373-4382395 ATTGTCAAATAAAAAAAAAAAGG - Intergenic
986104544 5:4647381-4647403 AATCTGCAATGAAAGAATGAAGG - Intergenic
986350627 5:6876038-6876060 ATTCTGCAATAAAAGAAACCAGG - Intergenic
986436540 5:7737973-7737995 ATTCTGCAAGTAAAAAAAGAGGG + Intronic
986507530 5:8468086-8468108 ATTCTTCATTAAAAGAAACAAGG - Intergenic
986569641 5:9151900-9151922 ATTCTCCTTGAAAGGAAAGAGGG + Intronic
986875801 5:12107389-12107411 AATATTCAACAAAAGAAAGATGG + Intergenic
986882405 5:12190627-12190649 ATTCCCCAATAAAAGCAAGAAGG - Intergenic
986898760 5:12405281-12405303 ATGGTGAAATAAAAGAAAGATGG - Intergenic
986934006 5:12859969-12859991 ATTCTCCAATAAAAGAAAAGAGG - Intergenic
987115367 5:14722408-14722430 ATTCTTCAATAAAAGGAACCAGG + Intronic
987165855 5:15197130-15197152 ATTCTCTTATAAAAGAAAGGGGG - Intergenic
987637396 5:20562688-20562710 ATTTACCAATAAAAGAATAAAGG - Intronic
988116648 5:26901179-26901201 AATCTCCAATAATAACAAGAAGG + Intronic
988162636 5:27540978-27541000 ATTCTGCAATAAAAGGATCAAGG + Intergenic
988359558 5:30218172-30218194 ATTATCATATAAAAGTAAGAAGG - Intergenic
988600745 5:32637643-32637665 ATTCTCCACTAAAAGTAATCAGG - Intergenic
988853896 5:35207702-35207724 ATTCTCCAAAAACTGAAAAATGG + Intronic
989203498 5:38788690-38788712 ATTCTCCACTGAAAGAAAGCAGG + Intergenic
989381305 5:40812004-40812026 ATTCTCCAATAAAAGCAATCGGG - Intergenic
989703014 5:44293472-44293494 GTTCTCCAATAAAATAAAGTAGG + Intergenic
990599583 5:57344135-57344157 CTTCTCCAAGAAAGGAAAGCTGG - Intergenic
990662942 5:58038829-58038851 CTTCTCCAATAAAAGAAACTAGG + Intergenic
990858951 5:60304155-60304177 TTTATCCAATAAAGAAAAGAAGG - Intronic
991173268 5:63653765-63653787 ATTCTCACACAAAAGAAAAAGGG + Intergenic
991282332 5:64929349-64929371 GTTCTACAAAAAAAGAAAGGGGG + Intronic
991333393 5:65518345-65518367 ATTTTGCAATAAAAGTAAGATGG + Exonic
991367507 5:65884845-65884867 TATCTCAAAAAAAAGAAAGAAGG - Intergenic
991534630 5:67654431-67654453 ATTCTCTAATAAAAGTAACCAGG + Intergenic
992419413 5:76587175-76587197 ATTCTCATATAAAAGGAAAAAGG + Intronic
992433017 5:76728056-76728078 TTTGTCAAATAAAAGAAAAAGGG - Intronic
992743466 5:79796223-79796245 CTTCTGCAATAATAGAAAAATGG + Intronic
993026787 5:82656211-82656233 ATTCAGCAAGAAAAGTAAGAAGG + Intergenic
993270058 5:85785448-85785470 ATTCTCTAATGGAAGAAATAGGG + Intergenic
993302432 5:86227152-86227174 TTCCTCCAATAAAAGAATAAAGG + Intergenic
993484511 5:88466280-88466302 ATTATTCAATAAAAGAAATGAGG - Intergenic
993502199 5:88676561-88676583 ATCCTCCAAAAAAAAAAAGAGGG - Intergenic
993529904 5:89011392-89011414 ATTCTACACTAAAAGGTAGAAGG + Intergenic
993559222 5:89383014-89383036 ATTTTACAATAAAAGGAGGATGG - Intergenic
993699372 5:91099972-91099994 ATTCTCCCCTAAAAGAAACCAGG + Intronic
994040774 5:95257666-95257688 ATTCTCAAGTAAAAGAAAACAGG + Intronic
994315036 5:98323468-98323490 ATCCTCCAATAAAAGAAACCAGG - Intergenic
994343362 5:98658191-98658213 CTTCTCCAATATAAGTAATAAGG - Intergenic
995151915 5:108857962-108857984 ATTCTCCACTAAAAGGAACTAGG - Intronic
995202102 5:109437671-109437693 ATTCTCCAACGAAAGAAACCAGG + Intergenic
995437976 5:112159274-112159296 CTACTTCTATAAAAGAAAGAAGG - Intronic
995442540 5:112207945-112207967 ATTCTACAAAAAAAGACATATGG + Intronic
995757058 5:115517365-115517387 ATCCTCCAATAAAAGGAGCAGGG + Intergenic
995789561 5:115870757-115870779 AATCTCCAATGAAGGAGAGATGG - Intronic
995807707 5:116072100-116072122 ATTCTCCAATAAAAAGAACCTGG - Intergenic
996028002 5:118671615-118671637 ATACCACAATAACAGAAAGAAGG - Intergenic
996137608 5:119863835-119863857 ATTCACCAGTGAAAGAAAGCTGG + Intergenic
996248639 5:121298749-121298771 ATTTTCCAAAAAAAGTAAGTTGG + Intergenic
996384209 5:122893378-122893400 ATTATCCAATAAAAGGAGGCAGG - Intronic
996507343 5:124282667-124282689 ATTCTCAGTTAAGAGAAAGATGG - Intergenic
996598457 5:125232227-125232249 ATTCTCCAATAAAAGAAACCAGG - Intergenic
996889996 5:128407269-128407291 ATTTACAAATAAAAGAAATATGG - Intronic
996944709 5:129052931-129052953 ATTCTCCAATAAAAGGAAACAGG - Intergenic
997034327 5:130169954-130169976 ATTTAAAAATAAAAGAAAGATGG - Intronic
997078200 5:130706090-130706112 ATTTTTAAATAAAAGAAAAAAGG + Intergenic
997168997 5:131695452-131695474 ATTCCAGAAGAAAAGAAAGAAGG + Intronic
997201937 5:132015700-132015722 ACTCTCCAAAAAAAAAAAGGGGG - Intergenic
997693491 5:135843754-135843776 ATTCTCCAGGAAAACAAAGAAGG + Intronic
998221710 5:140287503-140287525 ACTCTCCAATAAAAGGAATCAGG + Intronic
998590734 5:143475251-143475273 ATTCTCCAATAAAGGGAACCAGG - Intergenic
998772308 5:145559878-145559900 CTTCTCCTATACAATAAAGAGGG - Intronic
999183596 5:149688817-149688839 AGTCTCCAAGAATGGAAAGAAGG + Intergenic
1000652702 5:163836847-163836869 AGTCTCAAATAAAAGAACAAGGG + Intergenic
1000787768 5:165567519-165567541 ATTCTCCAATAAAAGGAATCTGG - Intergenic
1001258809 5:170207678-170207700 ATTCTGCAATACAAGAGGGATGG - Intergenic
1001293304 5:170481305-170481327 TTTCTCCACTTAAAGAAACAGGG - Intronic
1001359992 5:171073721-171073743 ATTTTTCAATAAAAGGAAGCAGG + Intronic
1001423560 5:171606524-171606546 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1002156683 5:177287249-177287271 ATACACAAATAAAAGAAAGCAGG - Intronic
1002348764 5:178567281-178567303 ATTCTCCAATAAAAGGAACCAGG + Intronic
1003104846 6:3207590-3207612 CTTCTCTCATAAAAGAAAGAAGG + Intergenic
1003139899 6:3462544-3462566 ATTCTCCAATATAAGGAACCAGG + Intergenic
1003305384 6:4922325-4922347 ATTCTTCACCAAAAGCAAGAGGG - Intronic
1003469856 6:6419293-6419315 AGTCTTCAATAAAAGAAACCAGG - Intergenic
1003717184 6:8660045-8660067 TTTTTCCATTTAAAGAAAGAGGG + Intergenic
1003779045 6:9402640-9402662 ATGTTCCAATAAAAGCAATAAGG - Intergenic
1004267678 6:14163323-14163345 AAGCTCCATTAAAAGCAAGATGG + Intergenic
1004490729 6:16112341-16112363 ATTCTCCGCTAAAAGGAACAAGG + Intergenic
1004539378 6:16535267-16535289 ATTCTCCAATAAAACAAACCAGG + Intronic
1004868475 6:19878086-19878108 AGTCTCCAATAAAAGGAACCAGG + Intergenic
1004909608 6:20270285-20270307 AGTCTCAAAAAAAAAAAAGAGGG + Intergenic
1006540409 6:34735440-34735462 ATTCTCCAACAAAAGGAACCAGG - Intergenic
1006658230 6:35615336-35615358 TTTCTCCAATAAAAGGAATCAGG + Intronic
1006864135 6:37194854-37194876 ATTCTTCAATAAAAGGACCAAGG - Intergenic
1006967112 6:37999007-37999029 ATTCTCCAATAGAAGCAACCAGG + Intronic
1007818131 6:44539253-44539275 ATCCTCCCAGAAAAGAAAAAGGG - Intergenic
1007853585 6:44830470-44830492 ATACTCCCATAAAAGAAAATGGG + Intronic
1008395364 6:51000214-51000236 TTTCTCCAATAAAACAAGAAGGG - Intergenic
1009485304 6:64214496-64214518 CTACTGCTATAAAAGAAAGATGG - Intronic
1009568032 6:65339267-65339289 ATTCTCCAAAAATAGAATGCAGG + Intronic
1009706978 6:67265015-67265037 ATTCTCCAAAATCAGAATGAAGG - Intergenic
1009830274 6:68921199-68921221 ATTCCCTATTAAAAGGAAGAGGG + Intronic
1009996517 6:70901344-70901366 ATTCTCTTATAAAAGAAACCAGG + Intronic
1010216330 6:73405493-73405515 ATTCTCAGATAAGAGACAGATGG + Intronic
1010543496 6:77122173-77122195 ATTCTCCAATAAAATGAACCAGG + Intergenic
1010612982 6:77978463-77978485 ACACTCCAATAAAAGACAGTGGG + Intergenic
1010874962 6:81091144-81091166 ATTCCCCAATAAACTTAAGAGGG - Intergenic
1010985244 6:82415918-82415940 ATTCTTCAATAATACAAAGTTGG + Intergenic
1011000012 6:82577428-82577450 ATTCTCCAATAAAATGAACCAGG + Intergenic
1011008461 6:82675718-82675740 ATTCTCCAATGAAAGGAACCAGG + Intergenic
1011043559 6:83057539-83057561 ATTTTACAATTAAAGAAACAAGG + Intronic
1011130777 6:84050120-84050142 CTCCTCCAATTAAAGAAAAAAGG - Intronic
1011161412 6:84394483-84394505 CTTCTTAAGTAAAAGAAAGAAGG - Intergenic
1011284757 6:85711169-85711191 ATGTTCCACTAAAAGAAAGCAGG - Intergenic
1011567164 6:88688488-88688510 ATTCACCAATAAAAGAAACCAGG + Intronic
1011572623 6:88755540-88755562 ATTTTCCAATAAAAGCTAGGGGG + Intronic
1011655625 6:89549204-89549226 TGTCTCCAAAAAAAGAAAAAAGG + Intronic
1011727729 6:90227571-90227593 AATCTCCAAGAAAAGAAAAAGGG - Intronic
1011742042 6:90371808-90371830 ATTTACCAATAGAAGAAATACGG + Intergenic
1011886374 6:92100704-92100726 ATTCTTCAGTAAAAGAAACAGGG - Intergenic
1011907958 6:92396058-92396080 GTTTTCCAATAAAATAAAGCAGG - Intergenic
1011969401 6:93203500-93203522 ATTCTCACATAAAAAAAAAAAGG + Intergenic
1012469463 6:99554777-99554799 ATTCTCCAATAAAAGGTACCAGG - Intronic
1012511305 6:100005131-100005153 ATTCTCCAATAAAAGCAACCAGG + Intergenic
1012736323 6:102949584-102949606 ATTCTTCAATATAAGAATGAGGG - Intergenic
1012756962 6:103244105-103244127 ATTCTCCAATAAAAAGAACTAGG + Intergenic
1012807238 6:103909441-103909463 ATTGTCCCATCAGAGAAAGATGG - Intergenic
1013446494 6:110233780-110233802 ATTCTACATTAAAAAAAAGCTGG - Intronic
1013580036 6:111524569-111524591 ATTCTCCAATAACAGATTGAAGG - Intergenic
1013674771 6:112446290-112446312 ATTTTCCAATAAAAGGAAGCAGG + Intergenic
1013706987 6:112847957-112847979 ATTCTCCAATAAAAGTAAGCAGG - Intergenic
1014144150 6:117978202-117978224 AATGTCCAATAACAGAAATAAGG + Intronic
1014173621 6:118307257-118307279 ATTCTCAAATTGGAGAAAGAAGG + Intronic
1014368794 6:120579353-120579375 GGTCTCCCATAAAAGAAATAGGG + Intergenic
1014689894 6:124550498-124550520 ATTTTCCAATAAAAGTAACCAGG - Intronic
1015108734 6:129567935-129567957 ATTTTCCAACAAGAGAAATAGGG - Intergenic
1015413265 6:132918741-132918763 ATGCTTCATTAAAATAAAGAAGG + Intergenic
1015420964 6:133007841-133007863 ATTCTCCAATAGAAGGAACCTGG + Intergenic
1015552270 6:134424229-134424251 ATTGTCCATTAAAAAAAAAATGG + Intergenic
1015591447 6:134826656-134826678 AGTCTCTAAGAAATGAAAGAAGG + Intergenic
1015752735 6:136576667-136576689 ATTCTTCAATAAAAGGAATTGGG - Intronic
1015800033 6:137051377-137051399 ATTCTCCAATAAAATAAACCAGG - Intergenic
1016376523 6:143426559-143426581 ATTCTCCAAAACAGCAAAGACGG + Intronic
1016697298 6:147012292-147012314 ATTCTTCAATAAAAGGAATTAGG + Intergenic
1017643931 6:156521299-156521321 ATTCTCCAAGAAATGAATGACGG - Intergenic
1018081158 6:160260348-160260370 ACTATCCAATAGAAAAAAGAAGG - Intronic
1018496355 6:164349442-164349464 AATATACAATAAAAGAAACAAGG - Intergenic
1019252427 7:24656-24678 ATTCTCTAACAAAAGAAATCAGG + Intergenic
1019768105 7:2866103-2866125 TGTCTCAAATAAAAGAAAAAAGG - Intergenic
1020506113 7:8990600-8990622 ATGGTCCATAAAAAGAAAGATGG + Intergenic
1020522612 7:9211978-9212000 ATTCTCAAATAACAAAAATAAGG - Intergenic
1020611722 7:10405440-10405462 AATTTCCAACAAAATAAAGATGG - Intergenic
1021444714 7:20720045-20720067 ATTCTCCACTAAAAGAACCCAGG + Intronic
1022388105 7:29920622-29920644 CTTCCCCAATAAATGACAGATGG + Intronic
1022512328 7:30947042-30947064 ATTCTACAATAAAAGGAATCAGG - Intronic
1022779458 7:33564115-33564137 ATTTGCCAATAAAACAAAGAAGG - Intronic
1022932806 7:35138651-35138673 TTTCCCCAATAAAGGCAAGAAGG + Intergenic
1023559255 7:41455346-41455368 ATTCTCAAAGAGAGGAAAGATGG + Intergenic
1023563228 7:41497248-41497270 ACTTTCCAGAAAAAGAAAGACGG + Intergenic
1023726204 7:43144793-43144815 ATTCCACAATAAAAGAAAATAGG - Intronic
1023901487 7:44484157-44484179 ATTTTCCAAAAAAACAAAGCAGG + Intronic
1023902703 7:44495871-44495893 ATTCTCCAATAGAAGGAACCAGG + Intergenic
1024046362 7:45588366-45588388 ATTCTCCAATAAAAGGAACTGGG - Intronic
1024132375 7:46367342-46367364 ACTCTCTAATAAAAGAAACCAGG - Intergenic
1024418095 7:49131768-49131790 TTTCTAGAATAAAAGAAAGAAGG + Intergenic
1024455053 7:49596402-49596424 ATTCCCAGATAAAAGAAAGGTGG - Intergenic
1024562381 7:50655387-50655409 ATTCTCCAATAAAAGGAGCCAGG - Intronic
1024714746 7:52064845-52064867 ATTTTCCACTGAAAGAAGGAAGG - Intergenic
1024848805 7:53684375-53684397 ATTCTCCAGTAAAGGGAAGTAGG + Intergenic
1024879365 7:54068216-54068238 ACTCTCCATTAAAATAAACATGG - Intergenic
1024886038 7:54143916-54143938 ATTCTTCAATAAAAGGAAGCAGG + Intergenic
1024918219 7:54527141-54527163 ATTCTTCAATAAAATTAATAAGG - Intergenic
1025287210 7:57673966-57673988 AGTTTCCATTAAAAGAAAGAGGG + Intergenic
1025865325 7:65375489-65375511 TTTCTCCAAGAAATGAAAGCTGG - Intronic
1026032071 7:66802957-66802979 AATCACCAATAAAAGGTAGAAGG + Intronic
1026393955 7:69932277-69932299 ATGCTCTACTCAAAGAAAGAAGG - Intronic
1026437361 7:70411217-70411239 ATTCTCCTTAAAAAGGAAGAAGG + Intronic
1026453514 7:70550884-70550906 ATTCTCCAATAAAAAGAACTAGG + Intronic
1026504585 7:70971381-70971403 ATTTCCAAATAGAAGAAAGAAGG - Intergenic
1027045337 7:74987437-74987459 ATCCTCCCATAGAAGAAGGAAGG + Intronic
1027503021 7:78979234-78979256 ATCCTCCAATAAAAGGAACCAGG + Intronic
1027609999 7:80348618-80348640 ATTCTTCATTAAAAGAAATTTGG + Intergenic
1027691095 7:81345730-81345752 ATTCTTCAATAAAAGAAACCAGG + Intergenic
1027924083 7:84437466-84437488 ATGCTCTAATAAAACAAAAAAGG - Intronic
1027938156 7:84635979-84636001 ATGCTCCATTAAAAAAAAAAGGG - Intergenic
1027945318 7:84737666-84737688 ATATTCCAATAAAAGAAACCAGG - Intergenic
1028070814 7:86447961-86447983 ATTCTCAAAAGAAAGAAAGAAGG + Intergenic
1028260701 7:88660768-88660790 ATTCTCCAATAAAATGAACCAGG - Intergenic
1028284550 7:88980577-88980599 CTTATCCAAGAAAACAAAGATGG - Intronic
1028702278 7:93793688-93793710 ATTCTTGAATTAAAGATAGATGG + Intronic
1028783690 7:94767655-94767677 CTTCTCCACTAAAAGAAACCAGG - Intergenic
1029828100 7:103222112-103222134 ATTCTCCTCTAAAAGGAAGCAGG + Intergenic
1029828724 7:103231415-103231437 TTTCCCCAATAAAGGCAAGAAGG + Intergenic
1029954090 7:104619422-104619444 ATTCTGAAAAAAAAGAAAAAGGG - Intronic
1030010933 7:105166502-105166524 ATTCAGCAAGAAAAGATAGATGG + Intronic
1030125843 7:106151826-106151848 TTTCTCCAGTAACAGAAGGAGGG + Intergenic
1030384849 7:108856289-108856311 CTTAACCAATAAATGAAAGAGGG - Intergenic
1030711327 7:112753542-112753564 ATTCTCCACTGAAAGGAATAAGG - Intergenic
1030712480 7:112766694-112766716 TTTCTCTTAGAAAAGAAAGAGGG - Exonic
1030972041 7:116070812-116070834 CTTCTCTAATAAAAGGAACATGG - Intronic
1031054206 7:116975958-116975980 ATGCTACATTAAAAGAAACAAGG + Intronic
1031219322 7:118945191-118945213 ATTCTCCAGTAAAAGACACCAGG - Intergenic
1031221139 7:118966952-118966974 ATTCTCCAATATGAGGAAGAGGG - Intergenic
1031279480 7:119779084-119779106 ATTCTCCAATAAAAGGAGATAGG + Intergenic
1031298487 7:120036020-120036042 ATTCTTCAGCAAAAGAAAGTAGG + Intergenic
1031745106 7:125486439-125486461 ATTGTCCAATAAAATAAACCAGG + Intergenic
1032243828 7:130189889-130189911 ATTCTCCATTAAAAGGAATCAGG + Intronic
1032372649 7:131374225-131374247 ACTCTCCAATAAAAGAAAACAGG - Intronic
1032685801 7:134232194-134232216 ATTTTCTACTCAAAGAAAGAAGG - Intronic
1032864585 7:135913251-135913273 ATTCTCCAGTAAAAGAACCAAGG - Intergenic
1032961879 7:137044832-137044854 ATTCTCCAATAAATGAACTCAGG - Intergenic
1033391247 7:140929854-140929876 ATTCTCCACTAAAAGTAACCAGG + Intergenic
1033413455 7:141141387-141141409 ATTCTCCAATAAAAGGAGCCAGG - Intronic
1033817238 7:145087985-145088007 ACTCACCAAAAAAAGAAAGAAGG - Intergenic
1033911254 7:146265899-146265921 ATTCTTCAAGCAAACAAAGAAGG - Intronic
1034058684 7:148066021-148066043 CTTCACAAATGAAAGAAAGATGG - Intronic
1034168492 7:149044341-149044363 ATTCTCCATTAAAAGGAGCAAGG + Intergenic
1034704795 7:153131265-153131287 ATTCTCCAAAAATATAAATATGG - Intergenic
1035658899 8:1332017-1332039 GTTCACCAGCAAAAGAAAGAAGG - Intergenic
1036436000 8:8733939-8733961 ATTCTCCAATAAAAGGAACTAGG - Intergenic
1036448202 8:8841897-8841919 TTTCTGCATTTAAAGAAAGAGGG + Intronic
1037029679 8:14089374-14089396 AACCTCCAATAAAAAATAGATGG + Intergenic
1037041503 8:14241606-14241628 AATCTCCTATAACAGAAATAAGG + Intronic
1037121993 8:15299724-15299746 AAAGTCCAATAAAAGAAAGCAGG + Intergenic
1037300303 8:17444255-17444277 ATTCTCCAGTAAAAGGAAGCAGG - Intergenic
1037529581 8:19759442-19759464 TGTCTCAAATAAAAAAAAGAGGG + Intergenic
1037856804 8:22377383-22377405 ATTCTCCAATAAAGGAAAGCAGG - Intronic
1038365305 8:26925829-26925851 TTTCTCCAATAAAAGGAACCAGG + Intergenic
1038585550 8:28785629-28785651 ATTCTCCACTAAAAGGAACCAGG - Intronic
1038642736 8:29340663-29340685 GTTCTCCAATGTGAGAAAGAAGG + Intronic
1038876008 8:31550323-31550345 ATTATCCAATAAAAGAAGCAGGG - Intergenic
1038936490 8:32257394-32257416 ATTTTCCAATAAAAGAAATATGG - Intronic
1039480148 8:37867129-37867151 ATTCCACAGTAAAAGGAAGATGG + Intronic
1039628164 8:39077872-39077894 ATTCTCCAAAAAAAGGAATTTGG - Intronic
1039667729 8:39553965-39553987 ATTTTCCACTAAAAGAAATATGG + Intergenic
1039754391 8:40507863-40507885 ATACACCAATAATAGACAGAGGG - Intergenic
1039823697 8:41155630-41155652 ATTTTCAAAAAAAAGAAAGATGG + Intergenic
1039935765 8:42043594-42043616 GTTCTGCAAAAAAAGAAAAATGG + Intronic
1040326595 8:46346674-46346696 ATTCTGCAATAAAAATTAGAAGG + Intergenic
1040573448 8:48629270-48629292 ATCCTCCAATAAAAGAAACAAGG - Intergenic
1040831192 8:51679154-51679176 ATTTTCAACTAAAAGGAAGAAGG - Intronic
1040868367 8:52073993-52074015 CCTCTCAAATAGAAGAAAGATGG + Intergenic
1040914235 8:52552864-52552886 ATTCTCCAGTAAAAGAACCAGGG - Intronic
1040938735 8:52810802-52810824 ATTCTCAGATAAAGGAAAGCTGG - Intergenic
1041169419 8:55126104-55126126 ATTAATTAATAAAAGAAAGAAGG + Intronic
1042105537 8:65322392-65322414 ATTGTTCATTAAATGAAAGAAGG - Intergenic
1042307832 8:67349883-67349905 AGTCTCCAAAAAAATAAAAAAGG + Intergenic
1042437558 8:68784927-68784949 ATTCTCCAATGAAAGAACCAGGG - Intronic
1042491510 8:69404132-69404154 ATTCTCCATTAAAAGAAACCAGG - Intergenic
1042884930 8:73538461-73538483 AGTCTTCAATCAATGAAAGAAGG + Intronic
1042950020 8:74191613-74191635 ATTCTCCAATAGAAGGAACCAGG - Intergenic
1043029251 8:75111303-75111325 CTTCTCTAAGACAAGAAAGAAGG - Intergenic
1043202130 8:77383444-77383466 TCTCTCCAAAAAAAAAAAGAAGG + Intergenic
1043284517 8:78513203-78513225 ATTCTCCCATAAAAGGAACAAGG + Intergenic
1043371740 8:79602368-79602390 ATTCTCCACTAAAAGAAACTAGG - Intergenic
1043675680 8:82949637-82949659 AATCTTCAATAAAAGGAACATGG + Intergenic
1043802739 8:84631223-84631245 ATTGTCCAAGAAAAGAAATATGG + Intronic
1044254354 8:90042947-90042969 ATTATCGAATATAAGAAATAAGG + Intronic
1044651714 8:94502655-94502677 ATTCTCCAATAAAAGGAACCAGG + Intronic
1044708420 8:95031150-95031172 ATTCTCCACTGAAAGAAACTAGG - Intronic
1044894067 8:96869870-96869892 ATTCTATAATGAAAGAAAGTTGG + Intronic
1045016906 8:98008261-98008283 ATTCTTCAGTAAAGGAGAGAAGG - Intronic
1045151208 8:99410421-99410443 ATTCTTAAATCAAAGACAGAAGG - Intronic
1045278953 8:100732189-100732211 ATTGCCAAATAAAAGAAATAAGG + Intergenic
1046605197 8:116363926-116363948 ATTCTGCAAGAAAAGAAAAATGG + Intergenic
1047115401 8:121836479-121836501 ACTCTTCAATAAAAACAAGAGGG + Intergenic
1047381012 8:124362870-124362892 AAACTGCAAAAAAAGAAAGAGGG + Intronic
1047559192 8:125967935-125967957 ATTCTCCAATAAAAGGGACCAGG - Intergenic
1047680453 8:127249174-127249196 ATCGTCCAAAAAAAGAAATATGG - Intergenic
1047914332 8:129565775-129565797 ATTCTCCAACCACAGAAAGTTGG + Intergenic
1048171049 8:132106756-132106778 ATTCTCCACTGAGAGAGAGATGG + Intronic
1048200415 8:132369451-132369473 ATTGTCCAATAAAAGAAACCAGG + Intronic
1048388152 8:133932987-133933009 ATTCTCCAATAAAGGGAACCAGG - Intergenic
1048469312 8:134693176-134693198 ACTCTCCACTAAAAGAAACCAGG + Intronic
1049240082 8:141533248-141533270 ATTCTCAAAGAAGAGAAAGAAGG - Intergenic
1050072362 9:1828829-1828851 ATTCTCCAATAAAAGGAGTTGGG + Intergenic
1050571207 9:6941034-6941056 TTTCTCCAAAAAAAAAAAAAAGG - Intronic
1050599729 9:7238348-7238370 ATTCACCAACAAAAGATACAGGG + Intergenic
1050780591 9:9329605-9329627 ATTCTCTAACAGAAGATAGAAGG - Intronic
1051242941 9:15079452-15079474 TGTCTCCAAAAAAAGAAAGAAGG + Intergenic
1051310686 9:15767840-15767862 CTACTCCAAGAAAGGAAAGAGGG - Intronic
1051803285 9:20961459-20961481 ATGCTCCACTAAAAGAAACCTGG - Intronic
1051995724 9:23215080-23215102 ATTCACCATTAAAAGGAAGCAGG + Intergenic
1052769493 9:32674407-32674429 ACTCTCCATCAAAGGAAAGAAGG + Intergenic
1052825830 9:33173702-33173724 ATTCTCCAATAAAAGGACCTAGG + Intergenic
1053030542 9:34773311-34773333 ATCCTCCAATAAAACGAAGCAGG + Intergenic
1053326186 9:37153788-37153810 ATTCTCCAATTAAAGAAACCAGG - Intronic
1053575229 9:39353384-39353406 GTTCTGCAATAAAACAAATATGG - Intergenic
1053712348 9:40830581-40830603 ATCTTCCAATAAAAAATAGAAGG + Intergenic
1053751114 9:41256368-41256390 ATTCTCCAATAACAGACAGAAGG + Intergenic
1053839733 9:42181318-42181340 GTTCTGCAATAAAACAAATATGG - Intergenic
1054096791 9:60912067-60912089 GTTCTGCAATAAAACAAATATGG - Intergenic
1054118195 9:61187693-61187715 GTTCTGCAATAAAACAAATATGG - Intergenic
1054256633 9:62820697-62820719 ATTCTCCAATAACAGACAGAAGG + Intergenic
1054334676 9:63794915-63794937 ATTCTCCAATAACAGACAGAAGG - Intergenic
1054422888 9:64963829-64963851 ATCTTCCAATAAAAAATAGAAGG + Intergenic
1054589560 9:66994871-66994893 GTTCTGCAATAAAACAAATATGG + Intergenic
1054992141 9:71340809-71340831 ATTTTCCAGTAAAAGAAACCAGG + Intronic
1055221206 9:73934266-73934288 ATTATCCAAAAAAAAAAAAAGGG + Intergenic
1055466693 9:76573586-76573608 ATTCTCCACTAAAAGAAACCAGG - Intergenic
1055746422 9:79450494-79450516 ATTCTCCAATCAAAGGAACCAGG - Intergenic
1055881198 9:81005987-81006009 ATTATCCATCAAAAGTAAGAGGG + Intergenic
1055978808 9:81980456-81980478 ATTCTCCAATAAAGGAACAAGGG - Intergenic
1056149904 9:83775367-83775389 ATTCTCCAGTAAAAGGAACCAGG - Intronic
1056175620 9:84032080-84032102 ATTTTCCACTAAAAGAAGTAAGG - Intergenic
1056449135 9:86698346-86698368 ATTTTCCAACGAAAGAAACAAGG - Intergenic
1056482992 9:87024816-87024838 TTTCTGCAAAAAAAGAAAGCTGG - Intergenic
1056723692 9:89093547-89093569 AGTCTCCAAAAAAAAAAAAAGGG + Intronic
1056851687 9:90090012-90090034 ATTCTCCAATAAAAAGAACCAGG - Intergenic
1057110087 9:92461149-92461171 ATACTCCAGCAAAAGAAATATGG - Intronic
1057322766 9:94030205-94030227 CCTCTCCCATAAAAGAAAGTGGG - Intergenic
1057323877 9:94041824-94041846 ATTTTCCAATAAAAGGAACCAGG - Intronic
1057363759 9:94399297-94399319 ATTCTCAAATAAAAGAAACCAGG - Intronic
1057659575 9:96988790-96988812 ATTCTCAAATAAAAGAAACCAGG + Intronic
1057746334 9:97754793-97754815 ATTCTCCAATAAAAGGAACCAGG - Intergenic
1057818450 9:98313284-98313306 ATTCTCCACTAAAAAGAACAAGG - Intronic
1057841940 9:98493321-98493343 ATTCTCCAGTAAAAGGAACCAGG - Intronic
1058052124 9:100416861-100416883 ATTCTCCAATAAAAGGGACCAGG - Intergenic
1058311075 9:103503504-103503526 ATTTTCCATTAAAAAAAAAAAGG + Intergenic
1058505877 9:105665614-105665636 TGTCTCAAAGAAAAGAAAGAAGG + Intergenic
1058808930 9:108620270-108620292 GTTCTACAATAAAAGGAAGAAGG + Intergenic
1059794490 9:117677552-117677574 GTTCTGGAATAAAAGATAGATGG - Intergenic
1060169651 9:121451130-121451152 ATTCTCCAAAAAAAGCAAAATGG + Intergenic
1060178094 9:121512345-121512367 GTTCCCTAATAAAAGAAATAAGG - Intergenic
1060340573 9:122772188-122772210 ATTCTATCATAAAAGAAGGAAGG + Intergenic
1060391578 9:123282003-123282025 ATTAGCCAATAACAGAATGAGGG - Intergenic
1060626046 9:125112708-125112730 ATTCTCCAATAAAAGGAATCAGG + Intronic
1060652372 9:125339499-125339521 ATTTTTCATTAAAAGAAATAAGG - Intronic
1061210185 9:129187170-129187192 ATCCTTCAAAAAGAGAAAGAAGG - Intergenic
1062747940 9:138227715-138227737 ATTCTCTAACAAAAGAAATCAGG - Intergenic
1203655356 Un_KI270752v1:18791-18813 ATACTCCAATAGAAGAGAGCAGG - Intergenic
1185484088 X:469009-469031 CGTCTCAAAAAAAAGAAAGAGGG + Intergenic
1185742634 X:2546152-2546174 AATCTCCAATAATGGAGAGAGGG - Intergenic
1185860102 X:3569887-3569909 ATTTTCCTCTAAAGGAAAGAAGG + Intergenic
1186109428 X:6240293-6240315 ATTATCCAATAAAAGAATCCAGG + Intergenic
1186482812 X:9909040-9909062 TTTCTCCAATAAAAGGAACCAGG + Intronic
1186604276 X:11073454-11073476 ATTCTCAAATAAAAGAAACCAGG + Intergenic
1187112933 X:16320099-16320121 ATTCGCCAACAAAATACAGATGG - Intergenic
1187150519 X:16677512-16677534 GTTCTCCTATAAAAGGGAGAGGG + Intronic
1187202707 X:17150646-17150668 ATTCTCCAGTGACAGTAAGATGG - Exonic
1187674179 X:21699542-21699564 AGTCCTCAATAAAAGAAGGATGG + Intergenic
1187833384 X:23405827-23405849 ACTCTCCAACAAATGGAAGAAGG + Intergenic
1188133699 X:26468920-26468942 ATTCTCTTATAAAAGAAAGGGGG - Intergenic
1188373866 X:29403472-29403494 ATTCTCCAATAAAAGCAACATGG - Intronic
1188547827 X:31329354-31329376 ATTCAGCATTAAAAAAAAGAAGG + Intronic
1188590598 X:31829976-31829998 ATTCTCTCAGAAAAGAAAGTTGG + Intronic
1188593787 X:31871816-31871838 ATTTTTCCATTAAAGAAAGATGG - Intronic
1188886498 X:35557078-35557100 ATTGTCCAAAAAATTAAAGAAGG - Intergenic
1189143625 X:38633621-38633643 ATTCTACAAAAAAAGATGGAAGG - Intronic
1189670779 X:43406499-43406521 ATTCTCCAATAAAAGGACCCGGG - Intergenic
1189713420 X:43839765-43839787 TTTCTCAAATAAATGAAAGAAGG + Intronic
1189825071 X:44910151-44910173 ATTCTCTAATATAGGAATGAAGG + Intronic
1189851248 X:45178273-45178295 ATTCTCAAAATTAAGAAAGATGG + Intronic
1189982570 X:46525610-46525632 CTTCTCAAAAAAAAAAAAGAGGG + Intronic
1190150179 X:47939612-47939634 ATTCTCTAATAAAAGGAACCAGG + Intronic
1190402238 X:50048758-50048780 ATTTTCCAATAAAAGGAACCAGG - Intronic
1190521721 X:51285735-51285757 ATTTTCCAATAAAAGGAATCAGG - Intergenic
1191060380 X:56289364-56289386 ATTTTCCAGTAAAAGAAACCAGG - Intergenic
1191086617 X:56574630-56574652 ATTCTCCAATAAATGAAACCAGG - Intergenic
1191960408 X:66694976-66694998 ATTGTCCAACAAAATAAAAAGGG + Intergenic
1192111109 X:68365817-68365839 AATCTCCAAAAAAAAAAAAAAGG - Intronic
1192676834 X:73205700-73205722 ATTCACCAATAAAAGGAACAAGG + Intergenic
1193044292 X:77034939-77034961 AGTATCCAAAAAAAGAAAAATGG + Intergenic
1193600648 X:83505532-83505554 TTTTTTAAATAAAAGAAAGAAGG + Intergenic
1193920100 X:87414549-87414571 ATACACCAATAAAAGACAAACGG - Intergenic
1193955245 X:87851897-87851919 ATTCTCCAATAAAAGAAACTAGG + Intergenic
1193958066 X:87887135-87887157 ATTCTCCAATAAAAGGACACAGG + Intergenic
1194551520 X:95306745-95306767 ATTCTCAGATACAAGAAAAAAGG + Intergenic
1194943672 X:100042844-100042866 ATTCTGTAATCAAAGAAACAGGG - Intergenic
1194991093 X:100548164-100548186 ATTCTGAAAAAAAAGGAAGAAGG + Intergenic
1195543700 X:106091558-106091580 ATTCACCATTAAAAAAGAGAAGG + Intergenic
1195631470 X:107059934-107059956 ATTTCCCAATAAAAGGAAGTAGG + Intergenic
1196050547 X:111299261-111299283 ATACTCGATTAAAAGTAAGATGG + Exonic
1196064626 X:111449590-111449612 ATGTTACATTAAAAGAAAGAAGG + Intergenic
1196262119 X:113595347-113595369 ATTCTCCAGTAAAAGAAAGCAGG - Intergenic
1196270789 X:113708420-113708442 ATACACCAATAACAGACAGAGGG + Intergenic
1196286927 X:113893629-113893651 TTTCTCCAACAAAAGAAACCAGG - Intergenic
1196409396 X:115400097-115400119 TTTCTGGAATAAAAGAACGAAGG - Intergenic
1197125332 X:122939319-122939341 ATTCTCCAGTAAAAGGAACCTGG + Intergenic
1197197807 X:123720724-123720746 ATTCAGCCATAAAAAAAAGAAGG + Intronic
1197276421 X:124484777-124484799 ATTCTCCAATAAAGGGAACCAGG - Intronic
1197419632 X:126222688-126222710 ATTCTCCACTAAAAGGAAGCAGG - Intergenic
1197831552 X:130648433-130648455 CGTCTCCAAAAAAAAAAAGAAGG + Intronic
1197879340 X:131148803-131148825 ATTCTCCAATAAAAGAAACCAGG - Intergenic
1198000616 X:132431607-132431629 ATTCTCCAATAAAGGAACTCGGG - Intronic
1198007613 X:132513974-132513996 TTTCTGCAATAAAAGGAAGCTGG - Intergenic
1198209506 X:134503847-134503869 ATTCTCCAATAATGGAACCAGGG - Intronic
1198374151 X:136020969-136020991 ATTCTCCAATAAAAGGAACCAGG - Intronic
1198407140 X:136324842-136324864 ATTCCCCACTAAAAGGAAGAGGG - Intronic
1198466921 X:136911554-136911576 CATCTCAAAAAAAAGAAAGAAGG - Intergenic
1198778345 X:140205760-140205782 ATTCTCCAATAAAAAGAATCAGG - Intergenic
1198806120 X:140496661-140496683 ATTCTTCAATAAAAGGAACCAGG - Intergenic
1198815789 X:140588654-140588676 ATGCTGCAAAAAAAAAAAGACGG + Intergenic
1199221055 X:145316131-145316153 ATGCTCCAAATAAAGAAATAGGG + Intergenic
1199329159 X:146538704-146538726 ATTGCCCTTTAAAAGAAAGAAGG + Intergenic
1199502717 X:148526547-148526569 ATTTTCCAATAAAGGAAATTAGG - Intronic
1201486687 Y:14502308-14502330 ATTCTCCAATAAAAGAACCCAGG - Intergenic
1202111938 Y:21429858-21429880 TTTCTCTAATAAATGTAAGATGG + Intergenic