ID: 1160380212

View in Genome Browser
Species Human (GRCh38)
Location 18:78448821-78448843
Sequence TTCTCCAATAAAAGAAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380209_1160380212 0 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380212 18:78448821-78448843 TTCTCCAATAAAAGAAAGAGGGG No data
1160380207_1160380212 1 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380212 18:78448821-78448843 TTCTCCAATAAAAGAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380212 Original CRISPR TTCTCCAATAAAAGAAAGAG GGG Intergenic
No off target data available for this crispr