ID: 1160380213

View in Genome Browser
Species Human (GRCh38)
Location 18:78448825-78448847
Sequence AGAGCCCCTCTTTCTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380213_1160380217 1 Left 1160380213 18:78448825-78448847 CCAATAAAAGAAAGAGGGGCTCT No data
Right 1160380217 18:78448849-78448871 TGGAGAAATGGCTGATTGTAGGG No data
1160380213_1160380216 0 Left 1160380213 18:78448825-78448847 CCAATAAAAGAAAGAGGGGCTCT No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data
1160380213_1160380218 25 Left 1160380213 18:78448825-78448847 CCAATAAAAGAAAGAGGGGCTCT No data
Right 1160380218 18:78448873-78448895 TTCAGCAGCAAAGATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380213 Original CRISPR AGAGCCCCTCTTTCTTTTAT TGG (reversed) Intergenic
No off target data available for this crispr