ID: 1160380215

View in Genome Browser
Species Human (GRCh38)
Location 18:78448837-78448859
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380209_1160380215 16 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380215 18:78448837-78448859 AGAGGGGCTCTCTGGAGAAATGG No data
1160380207_1160380215 17 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380215 18:78448837-78448859 AGAGGGGCTCTCTGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380215 Original CRISPR AGAGGGGCTCTCTGGAGAAA TGG Intergenic