ID: 1160380216

View in Genome Browser
Species Human (GRCh38)
Location 18:78448848-78448870
Sequence CTGGAGAAATGGCTGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380207_1160380216 28 Left 1160380207 18:78448797-78448819 CCCAAATCATGGTTTCTAATAGG No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data
1160380213_1160380216 0 Left 1160380213 18:78448825-78448847 CCAATAAAAGAAAGAGGGGCTCT No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data
1160380209_1160380216 27 Left 1160380209 18:78448798-78448820 CCAAATCATGGTTTCTAATAGGA No data
Right 1160380216 18:78448848-78448870 CTGGAGAAATGGCTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380216 Original CRISPR CTGGAGAAATGGCTGATTGT AGG Intergenic
No off target data available for this crispr