ID: 1160380796

View in Genome Browser
Species Human (GRCh38)
Location 18:78453840-78453862
Sequence GGTCTTCCTCCCATGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380796_1160380804 11 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380804 18:78453874-78453896 TCCCAGGCAGCCCCCAGGGGAGG No data
1160380796_1160380800 6 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380800 18:78453869-78453891 CACCTTCCCAGGCAGCCCCCAGG No data
1160380796_1160380801 7 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380801 18:78453870-78453892 ACCTTCCCAGGCAGCCCCCAGGG No data
1160380796_1160380803 8 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380803 18:78453871-78453893 CCTTCCCAGGCAGCCCCCAGGGG No data
1160380796_1160380797 -5 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380797 18:78453858-78453880 AGACCACACGCCACCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380796 Original CRISPR GGTCTTCCTCCCATGAGCTG AGG (reversed) Intergenic
No off target data available for this crispr