ID: 1160380800

View in Genome Browser
Species Human (GRCh38)
Location 18:78453869-78453891
Sequence CACCTTCCCAGGCAGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160380790_1160380800 21 Left 1160380790 18:78453825-78453847 CCGTGCATGCCAGGCCCTCAGCT No data
Right 1160380800 18:78453869-78453891 CACCTTCCCAGGCAGCCCCCAGG No data
1160380793_1160380800 12 Left 1160380793 18:78453834-78453856 CCAGGCCCTCAGCTCATGGGAGG No data
Right 1160380800 18:78453869-78453891 CACCTTCCCAGGCAGCCCCCAGG No data
1160380795_1160380800 7 Left 1160380795 18:78453839-78453861 CCCTCAGCTCATGGGAGGAAGAC No data
Right 1160380800 18:78453869-78453891 CACCTTCCCAGGCAGCCCCCAGG No data
1160380796_1160380800 6 Left 1160380796 18:78453840-78453862 CCTCAGCTCATGGGAGGAAGACC No data
Right 1160380800 18:78453869-78453891 CACCTTCCCAGGCAGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160380800 Original CRISPR CACCTTCCCAGGCAGCCCCC AGG Intergenic
No off target data available for this crispr