ID: 1160384511

View in Genome Browser
Species Human (GRCh38)
Location 18:78486658-78486680
Sequence ATGGATGACCAACAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160384501_1160384511 27 Left 1160384501 18:78486608-78486630 CCTCCTGATGGGTGGCCAAGTCC No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data
1160384500_1160384511 30 Left 1160384500 18:78486605-78486627 CCTCCTCCTGATGGGTGGCCAAG No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data
1160384504_1160384511 6 Left 1160384504 18:78486629-78486651 CCACACTCTGCACCTGCAGCCTC No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data
1160384502_1160384511 24 Left 1160384502 18:78486611-78486633 CCTGATGGGTGGCCAAGTCCACA No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data
1160384503_1160384511 12 Left 1160384503 18:78486623-78486645 CCAAGTCCACACTCTGCACCTGC No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data
1160384506_1160384511 -6 Left 1160384506 18:78486641-78486663 CCTGCAGCCTCCTCCTGATGGAT No data
Right 1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160384511 Original CRISPR ATGGATGACCAACAGGAGCA AGG Intergenic
No off target data available for this crispr