ID: 1160385743

View in Genome Browser
Species Human (GRCh38)
Location 18:78495244-78495266
Sequence CACTACTGTAGGGCAGTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160385731_1160385743 29 Left 1160385731 18:78495192-78495214 CCACACTCTGAGATTCTGTGTGG No data
Right 1160385743 18:78495244-78495266 CACTACTGTAGGGCAGTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160385743 Original CRISPR CACTACTGTAGGGCAGTTTA CGG Intergenic
No off target data available for this crispr