ID: 1160387758

View in Genome Browser
Species Human (GRCh38)
Location 18:78506818-78506840
Sequence TTCCTCTGTAAAGCCCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160387752_1160387758 3 Left 1160387752 18:78506792-78506814 CCCTAGGAAGCAACGTGGCTTTC No data
Right 1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG No data
1160387746_1160387758 30 Left 1160387746 18:78506765-78506787 CCGCAGACGGGCGGTGGCTCTGT No data
Right 1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG No data
1160387751_1160387758 4 Left 1160387751 18:78506791-78506813 CCCCTAGGAAGCAACGTGGCTTT No data
Right 1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG No data
1160387753_1160387758 2 Left 1160387753 18:78506793-78506815 CCTAGGAAGCAACGTGGCTTTCC No data
Right 1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160387758 Original CRISPR TTCCTCTGTAAAGCCCAAGG CGG Intergenic