ID: 1160389036

View in Genome Browser
Species Human (GRCh38)
Location 18:78516517-78516539
Sequence CAGATTCCCAAAAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160389033_1160389036 23 Left 1160389033 18:78516471-78516493 CCTCTACTGTGAGATAAATCTTC No data
Right 1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160389036 Original CRISPR CAGATTCCCAAAAGAGAAGT GGG Intergenic
No off target data available for this crispr