ID: 1160389718

View in Genome Browser
Species Human (GRCh38)
Location 18:78521067-78521089
Sequence CGAAGGGCTGTGCACAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160389718_1160389722 -9 Left 1160389718 18:78521067-78521089 CCTACTCTGTGCACAGCCCTTCG No data
Right 1160389722 18:78521081-78521103 AGCCCTTCGGGGATACAGAAAGG No data
1160389718_1160389726 -2 Left 1160389718 18:78521067-78521089 CCTACTCTGTGCACAGCCCTTCG No data
Right 1160389726 18:78521088-78521110 CGGGGATACAGAAAGGTCAAGGG No data
1160389718_1160389725 -3 Left 1160389718 18:78521067-78521089 CCTACTCTGTGCACAGCCCTTCG No data
Right 1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG No data
1160389718_1160389727 19 Left 1160389718 18:78521067-78521089 CCTACTCTGTGCACAGCCCTTCG No data
Right 1160389727 18:78521109-78521131 GGCAGAGCCTCCCCTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160389718 Original CRISPR CGAAGGGCTGTGCACAGAGT AGG (reversed) Intergenic
No off target data available for this crispr