ID: 1160389725

View in Genome Browser
Species Human (GRCh38)
Location 18:78521087-78521109
Sequence TCGGGGATACAGAAAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160389718_1160389725 -3 Left 1160389718 18:78521067-78521089 CCTACTCTGTGCACAGCCCTTCG No data
Right 1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160389725 Original CRISPR TCGGGGATACAGAAAGGTCA AGG Intergenic
No off target data available for this crispr