ID: 1160393636

View in Genome Browser
Species Human (GRCh38)
Location 18:78556539-78556561
Sequence CACAGCACAGTGAACAGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160393636_1160393640 4 Left 1160393636 18:78556539-78556561 CCCGATCTGTTCACTGTGCTGTG No data
Right 1160393640 18:78556566-78556588 TTCCAGGCATTCGCAGTCCCTGG No data
1160393636_1160393641 5 Left 1160393636 18:78556539-78556561 CCCGATCTGTTCACTGTGCTGTG No data
Right 1160393641 18:78556567-78556589 TCCAGGCATTCGCAGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160393636 Original CRISPR CACAGCACAGTGAACAGATC GGG (reversed) Intergenic
No off target data available for this crispr