ID: 1160397052

View in Genome Browser
Species Human (GRCh38)
Location 18:78580244-78580266
Sequence CCCGGGGGCCCTTCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160397052_1160397057 -8 Left 1160397052 18:78580244-78580266 CCTGCAGATGAAGGGCCCCCGGG No data
Right 1160397057 18:78580259-78580281 CCCCCGGGGTCTCCATCTGGAGG No data
1160397052_1160397064 29 Left 1160397052 18:78580244-78580266 CCTGCAGATGAAGGGCCCCCGGG No data
Right 1160397064 18:78580296-78580318 TAGTCCTAAAACAACAGTGAGGG No data
1160397052_1160397063 28 Left 1160397052 18:78580244-78580266 CCTGCAGATGAAGGGCCCCCGGG No data
Right 1160397063 18:78580295-78580317 TTAGTCCTAAAACAACAGTGAGG No data
1160397052_1160397059 -7 Left 1160397052 18:78580244-78580266 CCTGCAGATGAAGGGCCCCCGGG No data
Right 1160397059 18:78580260-78580282 CCCCGGGGTCTCCATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160397052 Original CRISPR CCCGGGGGCCCTTCATCTGC AGG (reversed) Intergenic
No off target data available for this crispr