ID: 1160400835

View in Genome Browser
Species Human (GRCh38)
Location 18:78610368-78610390
Sequence CACCCAGCTGTGCTTCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160400835_1160400839 17 Left 1160400835 18:78610368-78610390 CCCCACGGAAGCACAGCTGGGTG No data
Right 1160400839 18:78610408-78610430 CCCACCCACTGACCCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160400835 Original CRISPR CACCCAGCTGTGCTTCCGTG GGG (reversed) Intergenic
No off target data available for this crispr