ID: 1160400906

View in Genome Browser
Species Human (GRCh38)
Location 18:78610829-78610851
Sequence GAATGAGGACATTTATCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160400903_1160400906 -4 Left 1160400903 18:78610810-78610832 CCACTTCCTGACTGTAAAGGAAT No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400899_1160400906 6 Left 1160400899 18:78610800-78610822 CCAGAAGACCCCACTTCCTGACT No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400896_1160400906 11 Left 1160400896 18:78610795-78610817 CCCTCCCAGAAGACCCCACTTCC No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400897_1160400906 10 Left 1160400897 18:78610796-78610818 CCTCCCAGAAGACCCCACTTCCT No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400895_1160400906 20 Left 1160400895 18:78610786-78610808 CCTTTCTGTCCCTCCCAGAAGAC No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400901_1160400906 -2 Left 1160400901 18:78610808-78610830 CCCCACTTCCTGACTGTAAAGGA No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400898_1160400906 7 Left 1160400898 18:78610799-78610821 CCCAGAAGACCCCACTTCCTGAC No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400905_1160400906 -10 Left 1160400905 18:78610816-78610838 CCTGACTGTAAAGGAATGAGGAC No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data
1160400902_1160400906 -3 Left 1160400902 18:78610809-78610831 CCCACTTCCTGACTGTAAAGGAA No data
Right 1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160400906 Original CRISPR GAATGAGGACATTTATCATA TGG Intergenic
No off target data available for this crispr