ID: 1160402391

View in Genome Browser
Species Human (GRCh38)
Location 18:78620528-78620550
Sequence CTGTCTCCAAGCTGACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160402391_1160402395 0 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402395 18:78620551-78620573 GCCTGACTCGGAGAATCCCTGGG No data
1160402391_1160402403 20 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402403 18:78620571-78620593 GGGCTGGCTCTGCCAAGAGGGGG No data
1160402391_1160402402 19 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402402 18:78620570-78620592 TGGGCTGGCTCTGCCAAGAGGGG No data
1160402391_1160402400 17 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402400 18:78620568-78620590 CCTGGGCTGGCTCTGCCAAGAGG No data
1160402391_1160402401 18 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402401 18:78620569-78620591 CTGGGCTGGCTCTGCCAAGAGGG No data
1160402391_1160402394 -1 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402394 18:78620550-78620572 GGCCTGACTCGGAGAATCCCTGG No data
1160402391_1160402397 4 Left 1160402391 18:78620528-78620550 CCTGGAAGTCAGCTTGGAGACAG No data
Right 1160402397 18:78620555-78620577 GACTCGGAGAATCCCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160402391 Original CRISPR CTGTCTCCAAGCTGACTTCC AGG (reversed) Intergenic
No off target data available for this crispr