ID: 1160407922

View in Genome Browser
Species Human (GRCh38)
Location 18:78655443-78655465
Sequence GGGTGCCACCGTGGGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160407910_1160407922 13 Left 1160407910 18:78655407-78655429 CCAGGCAAATGGTGGAGAGCAGG No data
Right 1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG No data
1160407907_1160407922 21 Left 1160407907 18:78655399-78655421 CCTCAGTCCCAGGCAAATGGTGG No data
Right 1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG No data
1160407905_1160407922 23 Left 1160407905 18:78655397-78655419 CCCCTCAGTCCCAGGCAAATGGT No data
Right 1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG No data
1160407906_1160407922 22 Left 1160407906 18:78655398-78655420 CCCTCAGTCCCAGGCAAATGGTG No data
Right 1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG No data
1160407909_1160407922 14 Left 1160407909 18:78655406-78655428 CCCAGGCAAATGGTGGAGAGCAG No data
Right 1160407922 18:78655443-78655465 GGGTGCCACCGTGGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160407922 Original CRISPR GGGTGCCACCGTGGGGGATG GGG Intergenic
No off target data available for this crispr