ID: 1160411166

View in Genome Browser
Species Human (GRCh38)
Location 18:78676385-78676407
Sequence CCGCAATGCCGCATTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160411160_1160411166 14 Left 1160411160 18:78676348-78676370 CCGCATTTCTCCAAGGCTGGAGC No data
Right 1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG No data
1160411156_1160411166 25 Left 1160411156 18:78676337-78676359 CCACCGCAATGCCGCATTTCTCC No data
Right 1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG No data
1160411155_1160411166 26 Left 1160411155 18:78676336-78676358 CCCACCGCAATGCCGCATTTCTC No data
Right 1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG No data
1160411161_1160411166 4 Left 1160411161 18:78676358-78676380 CCAAGGCTGGAGCAGATTCCGAT No data
Right 1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG No data
1160411157_1160411166 22 Left 1160411157 18:78676340-78676362 CCGCAATGCCGCATTTCTCCAAG No data
Right 1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160411166 Original CRISPR CCGCAATGCCGCATTTCTCC AGG Intergenic