ID: 1160411198

View in Genome Browser
Species Human (GRCh38)
Location 18:78676610-78676632
Sequence CCGCAATGCCGCATTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160411193_1160411198 14 Left 1160411193 18:78676573-78676595 CCGCATTTCTCCAAGGCTGGAGC No data
Right 1160411198 18:78676610-78676632 CCGCAATGCCGCATTTCTCCAGG No data
1160411190_1160411198 25 Left 1160411190 18:78676562-78676584 CCACAGCAATGCCGCATTTCTCC No data
Right 1160411198 18:78676610-78676632 CCGCAATGCCGCATTTCTCCAGG No data
1160411189_1160411198 26 Left 1160411189 18:78676561-78676583 CCCACAGCAATGCCGCATTTCTC No data
Right 1160411198 18:78676610-78676632 CCGCAATGCCGCATTTCTCCAGG No data
1160411194_1160411198 4 Left 1160411194 18:78676583-78676605 CCAAGGCTGGAGCAGATTCTGAT No data
Right 1160411198 18:78676610-78676632 CCGCAATGCCGCATTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160411198 Original CRISPR CCGCAATGCCGCATTTCTCC AGG Intergenic