ID: 1160413110

View in Genome Browser
Species Human (GRCh38)
Location 18:78688220-78688242
Sequence GGACAGAGAATACCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160413110_1160413111 -3 Left 1160413110 18:78688220-78688242 CCAGCATGTGGTATTCTCTGTCC No data
Right 1160413111 18:78688240-78688262 TCCCTCAGCCACCCAGCATGTGG No data
1160413110_1160413117 29 Left 1160413110 18:78688220-78688242 CCAGCATGTGGTATTCTCTGTCC No data
Right 1160413117 18:78688272-78688294 TCCCTCAGCCACCCAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160413110 Original CRISPR GGACAGAGAATACCACATGC TGG (reversed) Intergenic
No off target data available for this crispr