ID: 1160413265

View in Genome Browser
Species Human (GRCh38)
Location 18:78688887-78688909
Sequence GGGGGTAAACAGGGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160413253_1160413265 3 Left 1160413253 18:78688861-78688883 CCCAGGCAGGTGCAGGTCAGACA No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413245_1160413265 29 Left 1160413245 18:78688835-78688857 CCCCAGCTGCAGGAAAAGAATGC No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413254_1160413265 2 Left 1160413254 18:78688862-78688884 CCAGGCAGGTGCAGGTCAGACAG No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413246_1160413265 28 Left 1160413246 18:78688836-78688858 CCCAGCTGCAGGAAAAGAATGCC No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413251_1160413265 7 Left 1160413251 18:78688857-78688879 CCTCCCCAGGCAGGTGCAGGTCA No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413252_1160413265 4 Left 1160413252 18:78688860-78688882 CCCCAGGCAGGTGCAGGTCAGAC No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413247_1160413265 27 Left 1160413247 18:78688837-78688859 CCAGCTGCAGGAAAAGAATGCCT No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data
1160413244_1160413265 30 Left 1160413244 18:78688834-78688856 CCCCCAGCTGCAGGAAAAGAATG No data
Right 1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160413265 Original CRISPR GGGGGTAAACAGGGGGAGGC CGG Intergenic
No off target data available for this crispr