ID: 1160416937

View in Genome Browser
Species Human (GRCh38)
Location 18:78718120-78718142
Sequence CCCCACCAAGGTTTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160416929_1160416937 -7 Left 1160416929 18:78718104-78718126 CCTGCTGGGCTGGCCACCCCACC No data
Right 1160416937 18:78718120-78718142 CCCCACCAAGGTTTTGGGGAGGG No data
1160416926_1160416937 7 Left 1160416926 18:78718090-78718112 CCTATGCAGCAAAGCCTGCTGGG No data
Right 1160416937 18:78718120-78718142 CCCCACCAAGGTTTTGGGGAGGG No data
1160416924_1160416937 8 Left 1160416924 18:78718089-78718111 CCCTATGCAGCAAAGCCTGCTGG No data
Right 1160416937 18:78718120-78718142 CCCCACCAAGGTTTTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160416937 Original CRISPR CCCCACCAAGGTTTTGGGGA GGG Intergenic