ID: 1160419829

View in Genome Browser
Species Human (GRCh38)
Location 18:78736195-78736217
Sequence GCGCTTCACGCTCACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160419829_1160419835 -4 Left 1160419829 18:78736195-78736217 CCCTCCCCGTGAGCGTGAAGCGC No data
Right 1160419835 18:78736214-78736236 GCGCGGTCGATGCCCCGCAACGG No data
1160419829_1160419836 3 Left 1160419829 18:78736195-78736217 CCCTCCCCGTGAGCGTGAAGCGC No data
Right 1160419836 18:78736221-78736243 CGATGCCCCGCAACGGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160419829 Original CRISPR GCGCTTCACGCTCACGGGGA GGG (reversed) Intergenic
No off target data available for this crispr