ID: 1160424638

View in Genome Browser
Species Human (GRCh38)
Location 18:78771588-78771610
Sequence CAACGCACGGTGAAGTGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160424638_1160424642 -1 Left 1160424638 18:78771588-78771610 CCGAATCACTTCACCGTGCGTTG No data
Right 1160424642 18:78771610-78771632 GAAGGAAGCAGCTCAGCTATGGG No data
1160424638_1160424643 20 Left 1160424638 18:78771588-78771610 CCGAATCACTTCACCGTGCGTTG No data
Right 1160424643 18:78771631-78771653 GGTGTCTTATGTCCTCTACTAGG No data
1160424638_1160424641 -2 Left 1160424638 18:78771588-78771610 CCGAATCACTTCACCGTGCGTTG No data
Right 1160424641 18:78771609-78771631 TGAAGGAAGCAGCTCAGCTATGG No data
1160424638_1160424644 28 Left 1160424638 18:78771588-78771610 CCGAATCACTTCACCGTGCGTTG No data
Right 1160424644 18:78771639-78771661 ATGTCCTCTACTAGGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160424638 Original CRISPR CAACGCACGGTGAAGTGATT CGG (reversed) Intergenic
No off target data available for this crispr