ID: 1160427793

View in Genome Browser
Species Human (GRCh38)
Location 18:78790302-78790324
Sequence TCCTGCATTGCGGTGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160427793_1160427802 2 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427802 18:78790327-78790349 CCAGGGCGTTGGGAGCTCCAGGG No data
1160427793_1160427800 1 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427800 18:78790326-78790348 CCCAGGGCGTTGGGAGCTCCAGG No data
1160427793_1160427798 -8 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427798 18:78790317-78790339 ATGCAGGAACCCAGGGCGTTGGG No data
1160427793_1160427797 -9 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427797 18:78790316-78790338 AATGCAGGAACCCAGGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160427793 Original CRISPR TCCTGCATTGCGGTGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr