ID: 1160427798

View in Genome Browser
Species Human (GRCh38)
Location 18:78790317-78790339
Sequence ATGCAGGAACCCAGGGCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160427793_1160427798 -8 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427798 18:78790317-78790339 ATGCAGGAACCCAGGGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160427798 Original CRISPR ATGCAGGAACCCAGGGCGTT GGG Intergenic
No off target data available for this crispr