ID: 1160427800

View in Genome Browser
Species Human (GRCh38)
Location 18:78790326-78790348
Sequence CCCAGGGCGTTGGGAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160427793_1160427800 1 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427800 18:78790326-78790348 CCCAGGGCGTTGGGAGCTCCAGG No data
1160427796_1160427800 -9 Left 1160427796 18:78790312-78790334 CCGCAATGCAGGAACCCAGGGCG No data
Right 1160427800 18:78790326-78790348 CCCAGGGCGTTGGGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160427800 Original CRISPR CCCAGGGCGTTGGGAGCTCC AGG Intergenic
No off target data available for this crispr