ID: 1160427802

View in Genome Browser
Species Human (GRCh38)
Location 18:78790327-78790349
Sequence CCAGGGCGTTGGGAGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160427793_1160427802 2 Left 1160427793 18:78790302-78790324 CCAGGAGACACCGCAATGCAGGA No data
Right 1160427802 18:78790327-78790349 CCAGGGCGTTGGGAGCTCCAGGG No data
1160427796_1160427802 -8 Left 1160427796 18:78790312-78790334 CCGCAATGCAGGAACCCAGGGCG No data
Right 1160427802 18:78790327-78790349 CCAGGGCGTTGGGAGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160427802 Original CRISPR CCAGGGCGTTGGGAGCTCCA GGG Intergenic
No off target data available for this crispr