ID: 1160428449

View in Genome Browser
Species Human (GRCh38)
Location 18:78794281-78794303
Sequence GGAGCCACACCCGTGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160428440_1160428449 23 Left 1160428440 18:78794235-78794257 CCCAGGGAGAGAGCATGGCATTG No data
Right 1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG No data
1160428441_1160428449 22 Left 1160428441 18:78794236-78794258 CCAGGGAGAGAGCATGGCATTGG No data
Right 1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG No data
1160428445_1160428449 -10 Left 1160428445 18:78794268-78794290 CCCAGAGTCCTCAGGAGCCACAC No data
Right 1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG No data
1160428439_1160428449 24 Left 1160428439 18:78794234-78794256 CCCCAGGGAGAGAGCATGGCATT No data
Right 1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG No data
1160428438_1160428449 27 Left 1160428438 18:78794231-78794253 CCACCCCAGGGAGAGAGCATGGC No data
Right 1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160428449 Original CRISPR GGAGCCACACCCGTGTAGCA GGG Intergenic
No off target data available for this crispr