ID: 1160430734

View in Genome Browser
Species Human (GRCh38)
Location 18:78810892-78810914
Sequence CAGAATCGCCGAGCCCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160430729_1160430734 3 Left 1160430729 18:78810866-78810888 CCTGAGAAAATGCAGCCATCCAG No data
Right 1160430734 18:78810892-78810914 CAGAATCGCCGAGCCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160430734 Original CRISPR CAGAATCGCCGAGCCCCCGG CGG Intergenic
No off target data available for this crispr