ID: 1160434687

View in Genome Browser
Species Human (GRCh38)
Location 18:78838345-78838367
Sequence CCATCAGCGCCCCCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160434679_1160434687 17 Left 1160434679 18:78838305-78838327 CCCATGGCACCCCATAGTCTGGC No data
Right 1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG No data
1160434680_1160434687 16 Left 1160434680 18:78838306-78838328 CCATGGCACCCCATAGTCTGGCA No data
Right 1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG No data
1160434683_1160434687 6 Left 1160434683 18:78838316-78838338 CCATAGTCTGGCACTCACGTCAC No data
Right 1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG No data
1160434681_1160434687 8 Left 1160434681 18:78838314-78838336 CCCCATAGTCTGGCACTCACGTC No data
Right 1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG No data
1160434682_1160434687 7 Left 1160434682 18:78838315-78838337 CCCATAGTCTGGCACTCACGTCA No data
Right 1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160434687 Original CRISPR CCATCAGCGCCCCCTCCCAG TGG Intergenic
No off target data available for this crispr