ID: 1160434708

View in Genome Browser
Species Human (GRCh38)
Location 18:78838400-78838422
Sequence AGCGCTGCCAGCCGAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160434708_1160434715 23 Left 1160434708 18:78838400-78838422 CCTCCATCTCGGCTGGCAGCGCT No data
Right 1160434715 18:78838446-78838468 TGCATGGTCTCAGTTAATACTGG No data
1160434708_1160434712 7 Left 1160434708 18:78838400-78838422 CCTCCATCTCGGCTGGCAGCGCT No data
Right 1160434712 18:78838430-78838452 AACTCCGAAAGCCTTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160434708 Original CRISPR AGCGCTGCCAGCCGAGATGG AGG (reversed) Intergenic
No off target data available for this crispr