ID: 1160435213

View in Genome Browser
Species Human (GRCh38)
Location 18:78846490-78846512
Sequence GACTCACAGTGCCACAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160435213_1160435217 15 Left 1160435213 18:78846490-78846512 CCAGTCCTGTGGCACTGTGAGTC No data
Right 1160435217 18:78846528-78846550 CTTTATCAGTTACCAAGTCGTGG No data
1160435213_1160435218 16 Left 1160435213 18:78846490-78846512 CCAGTCCTGTGGCACTGTGAGTC No data
Right 1160435218 18:78846529-78846551 TTTATCAGTTACCAAGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160435213 Original CRISPR GACTCACAGTGCCACAGGAC TGG (reversed) Intergenic
No off target data available for this crispr