ID: 1160435682

View in Genome Browser
Species Human (GRCh38)
Location 18:78850659-78850681
Sequence TTTGCTGCACAGAGGCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160435676_1160435682 12 Left 1160435676 18:78850624-78850646 CCATAGGTCACCTTTTCACTCTG No data
Right 1160435682 18:78850659-78850681 TTTGCTGCACAGAGGCTTTTGGG No data
1160435675_1160435682 18 Left 1160435675 18:78850618-78850640 CCAAGTCCATAGGTCACCTTTTC No data
Right 1160435682 18:78850659-78850681 TTTGCTGCACAGAGGCTTTTGGG No data
1160435677_1160435682 2 Left 1160435677 18:78850634-78850656 CCTTTTCACTCTGCTCGTTGCCT No data
Right 1160435682 18:78850659-78850681 TTTGCTGCACAGAGGCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160435682 Original CRISPR TTTGCTGCACAGAGGCTTTT GGG Intergenic
No off target data available for this crispr