ID: 1160439857

View in Genome Browser
Species Human (GRCh38)
Location 18:78881348-78881370
Sequence TTGAATATAGAGAAGTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160439857_1160439858 1 Left 1160439857 18:78881348-78881370 CCTTTGTACTTCTCTATATTCAA No data
Right 1160439858 18:78881372-78881394 ATATCTTTTTTTTTTTGAGACGG 0: 22
1: 544
2: 9054
3: 118868
4: 95302
1160439857_1160439860 11 Left 1160439857 18:78881348-78881370 CCTTTGTACTTCTCTATATTCAA No data
Right 1160439860 18:78881382-78881404 TTTTTTGAGACGGCGTAGGCTGG No data
1160439857_1160439859 7 Left 1160439857 18:78881348-78881370 CCTTTGTACTTCTCTATATTCAA No data
Right 1160439859 18:78881378-78881400 TTTTTTTTTTGAGACGGCGTAGG No data
1160439857_1160439861 21 Left 1160439857 18:78881348-78881370 CCTTTGTACTTCTCTATATTCAA No data
Right 1160439861 18:78881392-78881414 CGGCGTAGGCTGGAGTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160439857 Original CRISPR TTGAATATAGAGAAGTACAA AGG (reversed) Intergenic
No off target data available for this crispr