ID: 1160440890

View in Genome Browser
Species Human (GRCh38)
Location 18:78891549-78891571
Sequence CAGGACAGACAGATGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160440890_1160440894 5 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440894 18:78891577-78891599 CTGCCTGCCTGGCCAACTTCAGG No data
1160440890_1160440897 16 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data
1160440890_1160440891 -6 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160440890 Original CRISPR CAGGACAGACAGATGTGACA TGG (reversed) Intergenic
No off target data available for this crispr