ID: 1160440891

View in Genome Browser
Species Human (GRCh38)
Location 18:78891566-78891588
Sequence GTCCTGCCTGACTGCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160440888_1160440891 -4 Left 1160440888 18:78891547-78891569 CCCCATGTCACATCTGTCTGTCC No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data
1160440889_1160440891 -5 Left 1160440889 18:78891548-78891570 CCCATGTCACATCTGTCTGTCCT No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data
1160440887_1160440891 11 Left 1160440887 18:78891532-78891554 CCTGTTTCTCTTCGTCCCCATGT No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data
1160440890_1160440891 -6 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data
1160440886_1160440891 30 Left 1160440886 18:78891513-78891535 CCAGATGTACATGCAGGTTCCTG No data
Right 1160440891 18:78891566-78891588 GTCCTGCCTGACTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160440891 Original CRISPR GTCCTGCCTGACTGCCTGCC TGG Intergenic
No off target data available for this crispr