ID: 1160440894

View in Genome Browser
Species Human (GRCh38)
Location 18:78891577-78891599
Sequence CTGCCTGCCTGGCCAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160440888_1160440894 7 Left 1160440888 18:78891547-78891569 CCCCATGTCACATCTGTCTGTCC No data
Right 1160440894 18:78891577-78891599 CTGCCTGCCTGGCCAACTTCAGG No data
1160440887_1160440894 22 Left 1160440887 18:78891532-78891554 CCTGTTTCTCTTCGTCCCCATGT No data
Right 1160440894 18:78891577-78891599 CTGCCTGCCTGGCCAACTTCAGG No data
1160440890_1160440894 5 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440894 18:78891577-78891599 CTGCCTGCCTGGCCAACTTCAGG No data
1160440889_1160440894 6 Left 1160440889 18:78891548-78891570 CCCATGTCACATCTGTCTGTCCT No data
Right 1160440894 18:78891577-78891599 CTGCCTGCCTGGCCAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160440894 Original CRISPR CTGCCTGCCTGGCCAACTTC AGG Intergenic
No off target data available for this crispr