ID: 1160440897

View in Genome Browser
Species Human (GRCh38)
Location 18:78891588-78891610
Sequence GCCAACTTCAGGCTCTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160440888_1160440897 18 Left 1160440888 18:78891547-78891569 CCCCATGTCACATCTGTCTGTCC No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data
1160440890_1160440897 16 Left 1160440890 18:78891549-78891571 CCATGTCACATCTGTCTGTCCTG No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data
1160440892_1160440897 -3 Left 1160440892 18:78891568-78891590 CCTGCCTGACTGCCTGCCTGGCC No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data
1160440889_1160440897 17 Left 1160440889 18:78891548-78891570 CCCATGTCACATCTGTCTGTCCT No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data
1160440893_1160440897 -7 Left 1160440893 18:78891572-78891594 CCTGACTGCCTGCCTGGCCAACT No data
Right 1160440897 18:78891588-78891610 GCCAACTTCAGGCTCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160440897 Original CRISPR GCCAACTTCAGGCTCTGAAA TGG Intergenic
No off target data available for this crispr