ID: 1160441241

View in Genome Browser
Species Human (GRCh38)
Location 18:78894480-78894502
Sequence TCAGGATGGGTTGACTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160441232_1160441241 16 Left 1160441232 18:78894441-78894463 CCTCATGGGAGGTCCTGGCAGCA No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data
1160441235_1160441241 -8 Left 1160441235 18:78894465-78894487 CCCTTCCCTGTCTCATCAGGATG No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data
1160441231_1160441241 17 Left 1160441231 18:78894440-78894462 CCCTCATGGGAGGTCCTGGCAGC No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data
1160441230_1160441241 18 Left 1160441230 18:78894439-78894461 CCCCTCATGGGAGGTCCTGGCAG No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data
1160441233_1160441241 3 Left 1160441233 18:78894454-78894476 CCTGGCAGCAGCCCTTCCCTGTC No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data
1160441236_1160441241 -9 Left 1160441236 18:78894466-78894488 CCTTCCCTGTCTCATCAGGATGG No data
Right 1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160441241 Original CRISPR TCAGGATGGGTTGACTGTCC TGG Intergenic