ID: 1160441675

View in Genome Browser
Species Human (GRCh38)
Location 18:78898219-78898241
Sequence AATGATGACCATCATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160441667_1160441675 -2 Left 1160441667 18:78898198-78898220 CCCCTCCACAGCGAAGACAATAA No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data
1160441666_1160441675 17 Left 1160441666 18:78898179-78898201 CCATCGAAACACTGCAAAGCCCC No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data
1160441665_1160441675 20 Left 1160441665 18:78898176-78898198 CCACCATCGAAACACTGCAAAGC No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data
1160441669_1160441675 -4 Left 1160441669 18:78898200-78898222 CCTCCACAGCGAAGACAATAATG No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data
1160441670_1160441675 -7 Left 1160441670 18:78898203-78898225 CCACAGCGAAGACAATAATGATG No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data
1160441668_1160441675 -3 Left 1160441668 18:78898199-78898221 CCCTCCACAGCGAAGACAATAAT No data
Right 1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160441675 Original CRISPR AATGATGACCATCATGGGGG TGG Intergenic
No off target data available for this crispr