ID: 1160441826

View in Genome Browser
Species Human (GRCh38)
Location 18:78898985-78899007
Sequence GACGATGACCATCATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160441819_1160441826 13 Left 1160441819 18:78898949-78898971 CCTGGATACTGTGAAGCCCATCA No data
Right 1160441826 18:78898985-78899007 GACGATGACCATCATGGGGGTGG No data
1160441820_1160441826 -3 Left 1160441820 18:78898965-78898987 CCCATCATGATGAAGATGATGAC No data
Right 1160441826 18:78898985-78899007 GACGATGACCATCATGGGGGTGG No data
1160441821_1160441826 -4 Left 1160441821 18:78898966-78898988 CCATCATGATGAAGATGATGACG No data
Right 1160441826 18:78898985-78899007 GACGATGACCATCATGGGGGTGG No data
1160441818_1160441826 14 Left 1160441818 18:78898948-78898970 CCCTGGATACTGTGAAGCCCATC No data
Right 1160441826 18:78898985-78899007 GACGATGACCATCATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160441826 Original CRISPR GACGATGACCATCATGGGGG TGG Intergenic
No off target data available for this crispr